\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907961129:

Variant ID: vg0907961129 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7961129
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.68, C: 0.32, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAACTTTGACTATTTCTGTTTTAGAAAAAGGTTTACTACTTTTGGTAAAAAAATAATCTTGATTAAAAATGCATTATAAATCTCTTATCTAAAACCGC[T/C]
GGCAAATAAATATACATGCACGTAGATTTTCTTTTTCAAAACCGTGTAGTACATATAATTCAACTTAATTAGTTCTTGTTTGGTACTAGTTTTTCATAAA

Reverse complement sequence

TTTATGAAAAACTAGTACCAAACAAGAACTAATTAAGTTGAATTATATGTACTACACGGTTTTGAAAAAGAAAATCTACGTGCATGTATATTTATTTGCC[A/G]
GCGGTTTTAGATAAGAGATTTATAATGCATTTTTAATCAAGATTATTTTTTTACCAAAAGTAGTAAACCTTTTTCTAAAACAGAAATAGTCAAAGTTTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 43.60% 0.13% 0.00% NA
All Indica  2759 85.40% 14.50% 0.07% 0.00% NA
All Japonica  1512 3.50% 96.40% 0.07% 0.00% NA
Aus  269 78.80% 21.20% 0.00% 0.00% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 85.80% 14.00% 0.22% 0.00% NA
Indica III  913 79.60% 20.30% 0.11% 0.00% NA
Indica Intermediate  786 84.40% 15.60% 0.00% 0.00% NA
Temperate Japonica  767 5.70% 94.30% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.00% 0.20% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 38.90% 57.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907961129 T -> C LOC_Os09g13650.1 upstream_gene_variant ; 2917.0bp to feature; MODIFIER silent_mutation Average:31.395; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0907961129 T -> C LOC_Os09g13650.2 upstream_gene_variant ; 2917.0bp to feature; MODIFIER silent_mutation Average:31.395; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0907961129 T -> C LOC_Os09g13650.3 upstream_gene_variant ; 2917.0bp to feature; MODIFIER silent_mutation Average:31.395; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N
vg0907961129 T -> C LOC_Os09g13640-LOC_Os09g13650 intergenic_region ; MODIFIER silent_mutation Average:31.395; most accessible tissue: Zhenshan97 root, score: 60.612 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907961129 NA 3.15E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 1.96E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 1.48E-18 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 4.37E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 5.70E-09 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 1.01E-10 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 2.89E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 2.78E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 2.94E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 2.88E-10 mr1783_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 1.70E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 1.79E-09 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 2.96E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907961129 NA 1.32E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251