\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907959783:

Variant ID: vg0907959783 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7959783
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.11, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCTATTGGGTATCGTCCCTTTTCTCGGTGGGCAAGGTCCTCCTTTTATAGTTCAAGGGGATACCACATGCACCGCCTCTACCTACTCTTCTACGAAAG[G/A,T]
GGGACCCACTCTACCTTGACCGGACCGCGATCTATGCCTTTGCCCGGAAGCTAAGCTACAGTCTGCCCTTCAGTGGGACCCAGCGCCGCCCCCCACCTGA

Reverse complement sequence

TCAGGTGGGGGGCGGCGCTGGGTCCCACTGAAGGGCAGACTGTAGCTTAGCTTCCGGGCAAAGGCATAGATCGCGGTCCGGTCAAGGTAGAGTGGGTCCC[C/T,A]
CTTTCGTAGAAGAGTAGGTAGAGGCGGTGCATGTGGTATCCCCTTGAACTATAAAAGGAGGACCTTGCCCACCGAGAAAAGGGACGATACCCAATAGACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.90% 0.02% 0.00% NA
All Indica  2759 86.70% 13.30% 0.00% 0.00% NA
All Japonica  1512 34.20% 65.80% 0.00% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 86.90% 13.10% 0.00% 0.00% NA
Indica III  913 80.60% 19.40% 0.00% 0.00% NA
Indica Intermediate  786 86.30% 13.70% 0.00% 0.00% NA
Temperate Japonica  767 61.10% 38.90% 0.00% 0.00% NA
Tropical Japonica  504 1.60% 98.40% 0.00% 0.00% NA
Japonica Intermediate  241 16.60% 83.40% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 60.00% 38.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907959783 G -> T LOC_Os09g13650.1 upstream_gene_variant ; 4263.0bp to feature; MODIFIER N Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0907959783 G -> T LOC_Os09g13650.2 upstream_gene_variant ; 4263.0bp to feature; MODIFIER N Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0907959783 G -> T LOC_Os09g13650.3 upstream_gene_variant ; 4263.0bp to feature; MODIFIER N Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0907959783 G -> T LOC_Os09g13640-LOC_Os09g13650 intergenic_region ; MODIFIER N Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0907959783 G -> A LOC_Os09g13650.1 upstream_gene_variant ; 4263.0bp to feature; MODIFIER silent_mutation Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0907959783 G -> A LOC_Os09g13650.2 upstream_gene_variant ; 4263.0bp to feature; MODIFIER silent_mutation Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0907959783 G -> A LOC_Os09g13650.3 upstream_gene_variant ; 4263.0bp to feature; MODIFIER silent_mutation Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0907959783 G -> A LOC_Os09g13640-LOC_Os09g13650 intergenic_region ; MODIFIER silent_mutation Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907959783 NA 9.11E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 6.19E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 5.71E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 4.97E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 1.03E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 3.38E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 3.86E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 2.72E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 1.50E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 1.15E-07 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 6.68E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 1.87E-08 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 2.28E-07 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 1.99E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 7.55E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 1.95E-10 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 3.29E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 1.48E-07 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 3.56E-06 2.21E-06 mr1621_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 2.36E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783 NA 2.12E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251