Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907959783:

Variant ID: vg0907959783 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7959783
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.91, A: 0.11, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GGTCTATTGGGTATCGTCCCTTTTCTCGGTGGGCAAGGTCCTCCTTTTATAGTTCAAGGGGATACCACATGCACCGCCTCTACCTACTCTTCTACGAAAG[G/A,T]
GGGACCCACTCTACCTTGACCGGACCGCGATCTATGCCTTTGCCCGGAAGCTAAGCTACAGTCTGCCCTTCAGTGGGACCCAGCGCCGCCCCCCACCTGA

Reverse complement sequence

TCAGGTGGGGGGCGGCGCTGGGTCCCACTGAAGGGCAGACTGTAGCTTAGCTTCCGGGCAAAGGCATAGATCGCGGTCCGGTCAAGGTAGAGTGGGTCCC[C/T,A]
CTTTCGTAGAAGAGTAGGTAGAGGCGGTGCATGTGGTATCCCCTTGAACTATAAAAGGAGGACCTTGCCCACCGAGAAAAGGGACGATACCCAATAGACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.00%	31.90%	0.02%	0.00%	NA
All Indica	2759	86.70%	13.30%	0.00%	0.00%	NA
All Japonica	1512	34.20%	65.80%	0.00%	0.00%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	86.90%	13.10%	0.00%	0.00%	NA
Indica III	913	80.60%	19.40%	0.00%	0.00%	NA
Indica Intermediate	786	86.30%	13.70%	0.00%	0.00%	NA
Temperate Japonica	767	61.10%	38.90%	0.00%	0.00%	NA
Tropical Japonica	504	1.60%	98.40%	0.00%	0.00%	NA
Japonica Intermediate	241	16.60%	83.40%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	60.00%	38.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907959783	G -> T	LOC_Os09g13650.1	upstream_gene_variant ; 4263.0bp to feature; MODIFIER	N	Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0907959783	G -> T	LOC_Os09g13650.2	upstream_gene_variant ; 4263.0bp to feature; MODIFIER	N	Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0907959783	G -> T	LOC_Os09g13650.3	upstream_gene_variant ; 4263.0bp to feature; MODIFIER	N	Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0907959783	G -> T	LOC_Os09g13640-LOC_Os09g13650	intergenic_region ; MODIFIER	N	Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0907959783	G -> A	LOC_Os09g13650.1	upstream_gene_variant ; 4263.0bp to feature; MODIFIER	silent_mutation	Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0907959783	G -> A	LOC_Os09g13650.2	upstream_gene_variant ; 4263.0bp to feature; MODIFIER	silent_mutation	Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0907959783	G -> A	LOC_Os09g13650.3	upstream_gene_variant ; 4263.0bp to feature; MODIFIER	silent_mutation	Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0907959783	G -> A	LOC_Os09g13640-LOC_Os09g13650	intergenic_region ; MODIFIER	silent_mutation	Average:71.823; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907959783	NA	9.11E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	6.19E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	5.71E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	4.97E-09	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	1.03E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	3.38E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	3.86E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	2.72E-07	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	1.50E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	1.15E-07	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	6.68E-08	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	1.87E-08	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	2.28E-07	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	1.99E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	7.55E-10	mr1379_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	1.95E-10	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	3.29E-08	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	1.48E-07	mr1559_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	3.56E-06	2.21E-06	mr1621_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	2.36E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907959783	NA	2.12E-06	mr1696_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251