| Variant ID: vg0907955125 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7955125 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CATCAATAATTATTGTGAGAGGTATGAGACTAATCACGAAAAACATTGCTCAACCCGCCCATGACCGCGGGCGCAGCTATTCTAATAGTTTTACTCTGGC[C/T]
AGATGTAGAAGAAGGTACTGTAGTGATAGGGAGGAAAAACAGACTTTTCTGCCTAGGGCTGAGAGGAAGGGAGAGAATGGGTTGAATTCGGCCCAAGACT
AGTCTTGGGCCGAATTCAACCCATTCTCTCCCTTCCTCTCAGCCCTAGGCAGAAAAGTCTGTTTTTCCTCCCTATCACTACAGTACCTTCTTCTACATCT[G/A]
GCCAGAGTAAAACTATTAGAATAGCTGCGCCCGCGGTCATGGGCGGGTTGAGCAATGTTTTTCGTGATTAGTCTCATACCTCTCACAATAATTATTGATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 4.50% | 22.66% | 19.34% | NA |
| All Indica | 2759 | 67.30% | 5.10% | 18.34% | 9.21% | NA |
| All Japonica | 1512 | 34.80% | 0.30% | 25.73% | 39.15% | NA |
| Aus | 269 | 34.60% | 23.40% | 37.55% | 4.46% | NA |
| Indica I | 595 | 77.50% | 0.00% | 11.26% | 11.26% | NA |
| Indica II | 465 | 78.90% | 3.40% | 10.11% | 7.53% | NA |
| Indica III | 913 | 54.30% | 10.30% | 27.71% | 7.67% | NA |
| Indica Intermediate | 786 | 67.80% | 4.10% | 17.68% | 10.43% | NA |
| Temperate Japonica | 767 | 61.70% | 0.10% | 16.04% | 22.16% | NA |
| Tropical Japonica | 504 | 2.60% | 0.40% | 44.84% | 52.18% | NA |
| Japonica Intermediate | 241 | 16.60% | 0.80% | 16.60% | 65.98% | NA |
| VI/Aromatic | 96 | 2.10% | 2.10% | 52.08% | 43.75% | NA |
| Intermediate | 90 | 54.40% | 2.20% | 27.78% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907955125 | C -> DEL | N | N | silent_mutation | Average:39.264; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0907955125 | C -> T | LOC_Os09g13640.1 | upstream_gene_variant ; 1202.0bp to feature; MODIFIER | silent_mutation | Average:39.264; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0907955125 | C -> T | LOC_Os09g13640-LOC_Os09g13650 | intergenic_region ; MODIFIER | silent_mutation | Average:39.264; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907955125 | NA | 5.28E-10 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | NA | 5.46E-10 | mr1338 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | NA | 1.48E-10 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | NA | 6.84E-08 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | 6.24E-06 | NA | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | NA | 8.38E-07 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | NA | 3.96E-12 | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | NA | 1.01E-06 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | NA | 1.01E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907955125 | NA | 9.24E-06 | mr1621_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |