\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907955125:

Variant ID: vg0907955125 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7955125
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCAATAATTATTGTGAGAGGTATGAGACTAATCACGAAAAACATTGCTCAACCCGCCCATGACCGCGGGCGCAGCTATTCTAATAGTTTTACTCTGGC[C/T]
AGATGTAGAAGAAGGTACTGTAGTGATAGGGAGGAAAAACAGACTTTTCTGCCTAGGGCTGAGAGGAAGGGAGAGAATGGGTTGAATTCGGCCCAAGACT

Reverse complement sequence

AGTCTTGGGCCGAATTCAACCCATTCTCTCCCTTCCTCTCAGCCCTAGGCAGAAAAGTCTGTTTTTCCTCCCTATCACTACAGTACCTTCTTCTACATCT[G/A]
GCCAGAGTAAAACTATTAGAATAGCTGCGCCCGCGGTCATGGGCGGGTTGAGCAATGTTTTTCGTGATTAGTCTCATACCTCTCACAATAATTATTGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.50% 4.50% 22.66% 19.34% NA
All Indica  2759 67.30% 5.10% 18.34% 9.21% NA
All Japonica  1512 34.80% 0.30% 25.73% 39.15% NA
Aus  269 34.60% 23.40% 37.55% 4.46% NA
Indica I  595 77.50% 0.00% 11.26% 11.26% NA
Indica II  465 78.90% 3.40% 10.11% 7.53% NA
Indica III  913 54.30% 10.30% 27.71% 7.67% NA
Indica Intermediate  786 67.80% 4.10% 17.68% 10.43% NA
Temperate Japonica  767 61.70% 0.10% 16.04% 22.16% NA
Tropical Japonica  504 2.60% 0.40% 44.84% 52.18% NA
Japonica Intermediate  241 16.60% 0.80% 16.60% 65.98% NA
VI/Aromatic  96 2.10% 2.10% 52.08% 43.75% NA
Intermediate  90 54.40% 2.20% 27.78% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907955125 C -> DEL N N silent_mutation Average:39.264; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0907955125 C -> T LOC_Os09g13640.1 upstream_gene_variant ; 1202.0bp to feature; MODIFIER silent_mutation Average:39.264; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0907955125 C -> T LOC_Os09g13640-LOC_Os09g13650 intergenic_region ; MODIFIER silent_mutation Average:39.264; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907955125 NA 5.28E-10 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 NA 5.46E-10 mr1338 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 NA 1.48E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 NA 6.84E-08 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 6.24E-06 NA mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 NA 8.38E-07 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 NA 3.96E-12 mr1864 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 NA 1.01E-06 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 NA 1.01E-08 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907955125 NA 9.24E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251