| Variant ID: vg0907951531 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7951531 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 236. )
ATTTGTCTGGTCTAATCCGTGCGTGGTATAGGACACATGCAAATAGATGCAACCAATCTTAGACACATAGCTAGGCTACTAGGCTCTGCCATAATAAGTT[C/T,A]
CACGCCCGGAAATTCACTAGTAATTTCCGAAATAATTTGTGCATAAAATCCTCGTCCAGGAATCAGCCGAGGTACACAAACTAACAATTTAATATACAAA
TTTGTATATTAAATTGTTAGTTTGTGTACCTCGGCTGATTCCTGGACGAGGATTTTATGCACAAATTATTTCGGAAATTACTAGTGAATTTCCGGGCGTG[G/A,T]
AACTTATTATGGCAGAGCCTAGTAGCCTAGCTATGTGTCTAAGATTGGTTGCATCTATTTGCATGTGTCCTATACCACGCACGGATTAGACCAGACAAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.40% | 28.00% | 1.35% | 16.42% | A: 0.80% |
| All Indica | 2759 | 65.20% | 27.10% | 0.18% | 7.07% | A: 0.40% |
| All Japonica | 1512 | 30.10% | 33.90% | 2.98% | 31.55% | A: 1.46% |
| Aus | 269 | 85.10% | 8.60% | 0.74% | 5.20% | A: 0.37% |
| Indica I | 595 | 88.70% | 11.10% | 0.00% | 0.17% | NA |
| Indica II | 465 | 35.10% | 62.60% | 0.00% | 2.15% | A: 0.22% |
| Indica III | 913 | 65.00% | 17.40% | 0.33% | 16.32% | A: 0.99% |
| Indica Intermediate | 786 | 65.50% | 29.60% | 0.25% | 4.45% | A: 0.13% |
| Temperate Japonica | 767 | 22.70% | 61.10% | 0.65% | 14.47% | A: 1.04% |
| Tropical Japonica | 504 | 24.80% | 0.80% | 6.94% | 65.08% | A: 2.38% |
| Japonica Intermediate | 241 | 64.70% | 16.60% | 2.07% | 15.77% | A: 0.83% |
| VI/Aromatic | 96 | 8.30% | 5.20% | 7.29% | 75.00% | A: 4.17% |
| Intermediate | 90 | 37.80% | 36.70% | 5.56% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907951531 | C -> DEL | N | N | silent_mutation | Average:39.464; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0907951531 | C -> T | LOC_Os09g13640.1 | downstream_gene_variant ; 1292.0bp to feature; MODIFIER | silent_mutation | Average:39.464; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0907951531 | C -> T | LOC_Os09g13630-LOC_Os09g13640 | intergenic_region ; MODIFIER | silent_mutation | Average:39.464; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0907951531 | C -> A | LOC_Os09g13640.1 | downstream_gene_variant ; 1292.0bp to feature; MODIFIER | silent_mutation | Average:39.464; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0907951531 | C -> A | LOC_Os09g13630-LOC_Os09g13640 | intergenic_region ; MODIFIER | silent_mutation | Average:39.464; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907951531 | NA | 1.64E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 3.85E-09 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 9.31E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 5.28E-09 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 4.94E-08 | mr1332_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 3.75E-08 | mr1338_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 3.52E-07 | mr1359_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 2.49E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 3.84E-09 | mr1454_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | 9.70E-06 | NA | mr1579_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | 7.36E-06 | 7.36E-06 | mr1579_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 1.02E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907951531 | NA | 2.96E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |