\
| Variant ID: vg0907938886 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7938886 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 222. )
AAAAACTCAAAATCAACTCCAAATTTAAGGGCGTAAATTTAAAATTTGGCTGATAAGCATAAGCATAAGCATAAGCAAAAACATGAGGCTCAAAGTTGTG[G/A]
TTGGTTGAGAAGTGGAGATAGATGAGAAAATTGAATGATAAAGGGTTGTGGTTGGTTGAGAAGAAAATATTATTTTAGGATAAAACTTAAAGGCTAGAAG
CTTCTAGCCTTTAAGTTTTATCCTAAAATAATATTTTCTTCTCAACCAACCACAACCCTTTATCATTCAATTTTCTCATCTATCTCCACTTCTCAACCAA[C/T]
CACAACTTTGAGCCTCATGTTTTTGCTTATGCTTATGCTTATGCTTATCAGCCAAATTTTAAATTTACGCCCTTAAATTTGGAGTTGATTTTGAGTTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.90% | 32.00% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 8.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 25.50% | 74.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.50% | 18.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 15.10% | 84.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.80% | 38.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907938886 | G -> A | LOC_Os09g13630.1 | upstream_gene_variant ; 725.0bp to feature; MODIFIER | silent_mutation | Average:54.567; most accessible tissue: Zhenshan97 flower, score: 64.273 | N | N | N | N |
| vg0907938886 | G -> A | LOC_Os09g13630-LOC_Os09g13640 | intergenic_region ; MODIFIER | silent_mutation | Average:54.567; most accessible tissue: Zhenshan97 flower, score: 64.273 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907938886 | NA | 1.03E-13 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 1.30E-18 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | 5.59E-06 | 1.42E-06 | mr1579 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 1.97E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 4.44E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 2.34E-09 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 1.56E-19 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 1.34E-09 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 6.61E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 8.56E-12 | mr1756_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 4.84E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 7.64E-07 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907938886 | NA | 8.50E-06 | mr1856_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |