\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907938886:

Variant ID: vg0907938886 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7938886
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.93, G: 0.06, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAACTCAAAATCAACTCCAAATTTAAGGGCGTAAATTTAAAATTTGGCTGATAAGCATAAGCATAAGCATAAGCAAAAACATGAGGCTCAAAGTTGTG[G/A]
TTGGTTGAGAAGTGGAGATAGATGAGAAAATTGAATGATAAAGGGTTGTGGTTGGTTGAGAAGAAAATATTATTTTAGGATAAAACTTAAAGGCTAGAAG

Reverse complement sequence

CTTCTAGCCTTTAAGTTTTATCCTAAAATAATATTTTCTTCTCAACCAACCACAACCCTTTATCATTCAATTTTCTCATCTATCTCCACTTCTCAACCAA[C/T]
CACAACTTTGAGCCTCATGTTTTTGCTTATGCTTATGCTTATGCTTATCAGCCAAATTTTAAATTTACGCCCTTAAATTTGGAGTTGATTTTGAGTTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 32.00% 0.04% 0.00% NA
All Indica  2759 91.40% 8.60% 0.04% 0.00% NA
All Japonica  1512 25.50% 74.40% 0.07% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 81.50% 18.40% 0.11% 0.00% NA
Indica Intermediate  786 93.60% 6.40% 0.00% 0.00% NA
Temperate Japonica  767 15.10% 84.70% 0.13% 0.00% NA
Tropical Japonica  504 24.00% 76.00% 0.00% 0.00% NA
Japonica Intermediate  241 61.80% 38.20% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907938886 G -> A LOC_Os09g13630.1 upstream_gene_variant ; 725.0bp to feature; MODIFIER silent_mutation Average:54.567; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N
vg0907938886 G -> A LOC_Os09g13630-LOC_Os09g13640 intergenic_region ; MODIFIER silent_mutation Average:54.567; most accessible tissue: Zhenshan97 flower, score: 64.273 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907938886 NA 1.03E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 1.30E-18 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 5.59E-06 1.42E-06 mr1579 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 1.97E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 4.44E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 2.34E-09 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 1.56E-19 mr1657_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 1.34E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 6.61E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 8.56E-12 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 4.84E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 7.64E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907938886 NA 8.50E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251