Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0907839387:

Variant ID: vg0907839387 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7839387
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:

TCGCTAGTTCTCGAACCAGTACGTAGCAATCTCTCGCACCGCAACTTCCATTGGTGTTCGAGAGATAATTCTACTCACTCGCTGGTTCTCGAACCAGTAC[G/A]
TAGTAATCTCTCGCACCGAAACTTCCATTGGTGTTCGAGAGATAATTCTACTCGCTCGCTGGTCCTCGAACCAGTACGTAGCAATTTCTCGCACCGCAAC

Reverse complement sequence

GTTGCGGTGCGAGAAATTGCTACGTACTGGTTCGAGGACCAGCGAGCGAGTAGAATTATCTCTCGAACACCAATGGAAGTTTCGGTGCGAGAGATTACTA[C/T]
GTACTGGTTCGAGAACCAGCGAGTGAGTAGAATTATCTCTCGAACACCAATGGAAGTTGCGGTGCGAGAGATTGCTACGTACTGGTTCGAGAACTAGCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	1.30%	3.39%	3.60%	NA
All Indica	2759	99.10%	0.10%	0.36%	0.43%	NA
All Japonica	1512	77.00%	3.90%	9.59%	9.52%	NA
Aus	269	94.80%	0.00%	1.12%	4.09%	NA
Indica I	595	98.00%	0.00%	1.01%	1.01%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	99.90%	0.00%	0.00%	0.11%	NA
Indica Intermediate	786	98.70%	0.30%	0.51%	0.51%	NA
Temperate Japonica	767	82.80%	7.30%	6.39%	3.52%	NA
Tropical Japonica	504	81.50%	0.00%	8.73%	9.72%	NA
Japonica Intermediate	241	49.00%	1.20%	21.58%	28.22%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	0.00%	2.22%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907839387	G -> DEL	N	N	silent_mutation	Average:35.516; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0907839387	G -> A	LOC_Os09g13530.1	upstream_gene_variant ; 3747.0bp to feature; MODIFIER	silent_mutation	Average:35.516; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0907839387	G -> A	LOC_Os09g13520.1	downstream_gene_variant ; 417.0bp to feature; MODIFIER	silent_mutation	Average:35.516; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N
vg0907839387	G -> A	LOC_Os09g13520-LOC_Os09g13530	intergenic_region ; MODIFIER	silent_mutation	Average:35.516; most accessible tissue: Zhenshan97 flag leaf, score: 51.466	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907839387	2.94E-06	6.93E-10	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907839387	2.54E-07	2.54E-07	mr1456	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907839387	NA	6.34E-06	mr1677	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907839387	1.08E-06	1.08E-06	mr1950	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907839387	NA	4.29E-06	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251