\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907802333:

Variant ID: vg0907802333 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7802333
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTGCGTATAAGAAATAGATCCAATTACTACTATATAAACAGGCATTGGTACCGATTCGTAACTACTGGTGCCGGAAGTCAAACCGATACAAAGAGAC[G/A]
GAATAAAAACGGCATATTTACAAACGAAAATAATTGGATAAAACTTTTATATTCATATTCTTAGCGAAAAAAAGCAAATGTTAAAAAATAAATTTGGATG

Reverse complement sequence

CATCCAAATTTATTTTTTAACATTTGCTTTTTTTCGCTAAGAATATGAATATAAAAGTTTTATCCAATTATTTTCGTTTGTAAATATGCCGTTTTTATTC[C/T]
GTCTCTTTGTATCGGTTTGACTTCCGGCACCAGTAGTTACGAATCGGTACCAATGCCTGTTTATATAGTAGTAATTGGATCTATTTCTTATACGCAAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 10.00% 0.02% 0.34% NA
All Indica  2759 94.80% 5.20% 0.04% 0.00% NA
All Japonica  1512 77.50% 21.40% 0.00% 1.06% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 91.00% 9.00% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 91.90% 8.00% 0.13% 0.00% NA
Temperate Japonica  767 90.50% 9.40% 0.00% 0.13% NA
Tropical Japonica  504 73.40% 23.60% 0.00% 2.98% NA
Japonica Intermediate  241 44.80% 55.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907802333 G -> DEL N N silent_mutation Average:36.993; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0907802333 G -> A LOC_Os09g13470.1 downstream_gene_variant ; 2191.0bp to feature; MODIFIER silent_mutation Average:36.993; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0907802333 G -> A LOC_Os09g13480.1 downstream_gene_variant ; 1731.0bp to feature; MODIFIER silent_mutation Average:36.993; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N
vg0907802333 G -> A LOC_Os09g13470-LOC_Os09g13480 intergenic_region ; MODIFIER silent_mutation Average:36.993; most accessible tissue: Zhenshan97 young leaf, score: 65.804 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907802333 7.04E-06 NA mr1263 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907802333 7.04E-06 NA mr1451 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907802333 NA 3.90E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907802333 1.20E-07 1.20E-07 mr1634_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251