\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907798696:

Variant ID: vg0907798696 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7798696
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.78, G: 0.22, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CGACGACGAGCGGGCGTCCACGCTGAGGCGCTACCTGGCGGCCATCGCCGGCCTCGAAAGCGAGGCGCGGAGCTACTACCGCGATGACACGGATGACATG[G/A]
GCGCGGAGGAGTTTGCGTTGATGCTGCTGCTCGACGGGTGGTACATACTCCACTACTTCGGCGTCGGCGTCGGCGGCGGCGGGAGAGCGGTGGACATCTT

Reverse complement sequence

AAGATGTCCACCGCTCTCCCGCCGCCGCCGACGCCGACGCCGAAGTAGTGGAGTATGTACCACCCGTCGAGCAGCAGCATCAACGCAAACTCCTCCGCGC[C/T]
CATGTCATCCGTGTCATCGCGGTAGTAGCTCCGCGCCTCGCTTTCGAGGCCGGCGATGGCCGCCAGGTAGCGCCTCAGCGTGGACGCCCGCTCGTCGTCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.80% 12.90% 0.02% 0.34% NA
All Indica  2759 97.60% 2.40% 0.00% 0.00% NA
All Japonica  1512 66.70% 32.30% 0.00% 1.06% NA
Aus  269 86.20% 13.80% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.90% 0.00% 0.00% NA
Temperate Japonica  767 40.90% 58.90% 0.00% 0.13% NA
Tropical Japonica  504 96.60% 0.40% 0.00% 2.98% NA
Japonica Intermediate  241 85.90% 14.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907798696 G -> DEL LOC_Os09g13470.1 N frameshift_variant Average:82.438; most accessible tissue: Zhenshan97 young leaf, score: 90.363 N N N N
vg0907798696 G -> A LOC_Os09g13470.1 missense_variant ; p.Gly128Ser; MODERATE nonsynonymous_codon ; G128S Average:82.438; most accessible tissue: Zhenshan97 young leaf, score: 90.363 benign 0.398 TOLERATED 0.84

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0907798696 G A -0.02 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907798696 3.71E-06 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 2.36E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 7.16E-06 NA mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 NA 4.47E-06 mr1559 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 8.49E-07 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 6.51E-07 NA mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 1.00E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 6.74E-06 NA mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 1.86E-07 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 8.47E-07 NA mr1765 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 NA 3.87E-12 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 NA 1.81E-06 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 NA 4.19E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 NA 9.03E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907798696 NA 1.82E-10 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251