\
| Variant ID: vg0907792919 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7792919 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 222. )
GAACTATTAAAACCGGTGTAATTTGACTCCTTTGGTGGTTTTGGAGGATGGTTTCGCTGACGTGGCGCTGACGTGGCTGTGTTGACCTAGTCTATGGGTT[A/G]
ACGTGGCGCTTAGGTGGCATCTAAATTAAAAACATATAGGTGGGACCCGTTTGTCATTCACACATATAAAAATTTGTGGGGGCCATTGGCATATGGGCCC
GGGCCCATATGCCAATGGCCCCCACAAATTTTTATATGTGTGAATGACAAACGGGTCCCACCTATATGTTTTTAATTTAGATGCCACCTAAGCGCCACGT[T/C]
AACCCATAGACTAGGTCAACACAGCCACGTCAGCGCCACGTCAGCGAAACCATCCTCCAAAACCACCAAAGGAGTCAAATTACACCGGTTTTAATAGTTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.40% | 11.20% | 0.00% | 0.38% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 68.50% | 30.30% | 0.00% | 1.19% | NA |
| Aus | 269 | 86.20% | 13.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 44.60% | 55.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 96.20% | 0.40% | 0.00% | 3.37% | NA |
| Japonica Intermediate | 241 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907792919 | A -> G | LOC_Os09g13470.1 | upstream_gene_variant ; 4949.0bp to feature; MODIFIER | silent_mutation | Average:70.826; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0907792919 | A -> G | LOC_Os09g13460-LOC_Os09g13470 | intergenic_region ; MODIFIER | silent_mutation | Average:70.826; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0907792919 | A -> DEL | N | N | silent_mutation | Average:70.826; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907792919 | NA | 7.73E-08 | mr1002 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 8.35E-08 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 4.98E-09 | NA | mr1166 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 3.82E-06 | 3.82E-06 | mr1166 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 1.05E-07 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 2.13E-06 | NA | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 5.91E-07 | NA | mr1305 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 6.12E-06 | NA | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 8.46E-06 | mr1555 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 1.16E-06 | mr1559 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 4.58E-07 | NA | mr1585 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 1.29E-06 | NA | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 1.21E-07 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 2.21E-06 | NA | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 1.39E-07 | NA | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | 1.79E-06 | NA | mr1765 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 1.59E-09 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 6.03E-09 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 1.48E-12 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 5.18E-08 | mr1011_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 2.23E-07 | mr1013_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 1.13E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 4.80E-06 | mr1051_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 2.93E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 2.55E-07 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 1.29E-09 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 5.86E-07 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 8.78E-06 | mr1596_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 4.82E-10 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 3.63E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 1.91E-10 | mr1805_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 2.82E-08 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907792919 | NA | 6.82E-08 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |