Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0907773561:

Variant ID: vg0907773561 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7773561
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAAGATTTCAAATAATGTATCAGTATAACTGATAGTTATATATACTTCAGTGAATTGTTTTGTATATACATCAAGTACATGCGATTTATTTTGTTCTGT[G/A]
TTATAATTTTGACAGTTTTATATTCTTAAAACTGCCAAGATTTTGTCTTTTTTTTTCTGGCTGAAATATATTGAATTTAGATATGGTACTTCGAAGCTAG

Reverse complement sequence

CTAGCTTCGAAGTACCATATCTAAATTCAATATATTTCAGCCAGAAAAAAAAAGACAAAATCTTGGCAGTTTTAAGAATATAAAACTGTCAAAATTATAA[C/T]
ACAGAACAAAATAAATCGCATGTACTTGATGTATATACAAAACAATTCACTGAAGTATATATAACTATCAGTTATACTGATACATTATTTGAAATCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.10%	0.40%	0.89%	16.57%	NA
All Indica	2759	94.80%	0.00%	0.25%	4.93%	NA
All Japonica	1512	63.20%	1.40%	2.05%	33.33%	NA
Aus	269	84.80%	0.00%	0.00%	15.24%	NA
Indica I	595	94.80%	0.00%	0.00%	5.21%	NA
Indica II	465	98.50%	0.00%	0.22%	1.29%	NA
Indica III	913	93.90%	0.00%	0.33%	5.81%	NA
Indica Intermediate	786	93.80%	0.00%	0.38%	5.85%	NA
Temperate Japonica	767	81.90%	2.50%	3.13%	12.52%	NA
Tropical Japonica	504	28.40%	0.00%	1.19%	70.44%	NA
Japonica Intermediate	241	76.80%	0.80%	0.41%	21.99%	NA
VI/Aromatic	96	11.50%	0.00%	2.08%	86.46%	NA
Intermediate	90	76.70%	0.00%	2.22%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907773561	G -> DEL	N	N	silent_mutation	Average:40.811; most accessible tissue: Callus, score: 67.87	N	N	N	N
vg0907773561	G -> A	LOC_Os09g13430.1	downstream_gene_variant ; 393.0bp to feature; MODIFIER	silent_mutation	Average:40.811; most accessible tissue: Callus, score: 67.87	N	N	N	N
vg0907773561	G -> A	LOC_Os09g13440.2	downstream_gene_variant ; 2137.0bp to feature; MODIFIER	silent_mutation	Average:40.811; most accessible tissue: Callus, score: 67.87	N	N	N	N
vg0907773561	G -> A	LOC_Os09g13440.1	intron_variant ; MODIFIER	silent_mutation	Average:40.811; most accessible tissue: Callus, score: 67.87	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907773561	2.35E-06	2.35E-06	mr1346	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907773561	1.90E-06	1.90E-06	mr1456	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907773561	NA	5.46E-07	mr1167_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251