\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907746322:

Variant ID: vg0907746322 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7746322
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGGAACCACGTGCACGCCTAACAATAAGGTTTTGTGGGACAAATGCTTCTGTATGAAAAAGAAGTCTTTTAGAGACGGAAGAAGTATACCACAATAA[T/C]
TAAGTGGATATATTATAAAAATCGATCACTACCATAGAACACCACATCCAGACCGCCTCATTAGTATCGGTTATCCAAAAACTAACATTTATAGTGGTTC

Reverse complement sequence

GAACCACTATAAATGTTAGTTTTTGGATAACCGATACTAATGAGGCGGTCTGGATGTGGTGTTCTATGGTAGTGATCGATTTTTATAATATATCCACTTA[A/G]
TTATTGTGGTATACTTCTTCCGTCTCTAAAAGACTTCTTTTTCATACAGAAGCATTTGTCCCACAAAACCTTATTGTTAGGCGTGCACGTGGTTCCACTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 40.20% 0.11% 0.00% NA
All Indica  2759 90.10% 9.80% 0.11% 0.00% NA
All Japonica  1512 4.10% 95.80% 0.07% 0.00% NA
Aus  269 88.50% 11.20% 0.37% 0.00% NA
Indica I  595 88.10% 11.80% 0.17% 0.00% NA
Indica II  465 95.10% 4.70% 0.22% 0.00% NA
Indica III  913 91.80% 8.20% 0.00% 0.00% NA
Indica Intermediate  786 86.80% 13.10% 0.13% 0.00% NA
Temperate Japonica  767 6.40% 93.50% 0.13% 0.00% NA
Tropical Japonica  504 1.40% 98.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 34.40% 65.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907746322 T -> C LOC_Os09g13400.1 upstream_gene_variant ; 2351.0bp to feature; MODIFIER silent_mutation Average:57.912; most accessible tissue: Minghui63 root, score: 75.485 N N N N
vg0907746322 T -> C LOC_Os09g13400-LOC_Os09g13410 intergenic_region ; MODIFIER silent_mutation Average:57.912; most accessible tissue: Minghui63 root, score: 75.485 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907746322 NA 2.62E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 4.31E-06 1.51E-09 mr1062 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 2.36E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 5.94E-13 mr1239 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 6.96E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 1.50E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 1.64E-15 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 1.25E-08 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 2.35E-09 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 1.30E-08 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 3.09E-08 mr1488 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 2.14E-14 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 3.95E-08 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 1.42E-10 mr1623 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 1.19E-06 mr1646 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 1.30E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 2.25E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 1.48E-19 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 6.45E-08 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907746322 NA 5.08E-24 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251