Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907725198:

Variant ID: vg0907725198 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7725198
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAATGTAATTAATACAATAGTACTTTTTATTTAAGATTCTGTTAGAAAAAAGTAACAGTGACAAAGTTAGCGTAATTATTAGGTTCTTGTGGTGCAAC[C/T]
AGTACAACGGGTTCAAATCCTAGACTTGATACATGTGCTCACATTTACGGCTAATTATTCTTTCAGTGGTACACAACATATCAATCGACAGCAAAAGCTC

Reverse complement sequence

GAGCTTTTGCTGTCGATTGATATGTTGTGTACCACTGAAAGAATAATTAGCCGTAAATGTGAGCACATGTATCAAGTCTAGGATTTGAACCCGTTGTACT[G/A]
GTTGCACCACAAGAACCTAATAATTACGCTAACTTTGTCACTGTTACTTTTTTCTAACAGAATCTTAAATAAAAAGTACTATTGTATTAATTACATTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.10% 3.50% 1.33% 46.09% NA
All Indica  2759 23.20% 4.00% 1.34% 71.40% NA
All Japonica  1512 97.20% 0.10% 0.26% 2.45% NA
Aus  269 20.40% 18.20% 7.06% 54.28% NA
Indica I  595 13.10% 2.00% 0.84% 84.03% NA
Indica II  465 9.90% 7.30% 0.65% 82.15% NA
Indica III  913 37.90% 3.80% 1.42% 56.85% NA
Indica Intermediate  786 21.80% 3.80% 2.04% 72.39% NA
Temperate Japonica  767 95.70% 0.10% 0.52% 3.65% NA
Tropical Japonica  504 99.00% 0.00% 0.00% 0.99% NA
Japonica Intermediate  241 97.90% 0.40% 0.00% 1.66% NA
VI/Aromatic  96 95.80% 0.00% 1.04% 3.12% NA
Intermediate  90 70.00% 3.30% 2.22% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907725198 C -> DEL N N silent_mutation Average:29.068; most accessible tissue: Callus, score: 70.189 N N N N
vg0907725198 C -> T LOC_Os09g13380.1 upstream_gene_variant ; 4421.0bp to feature; MODIFIER silent_mutation Average:29.068; most accessible tissue: Callus, score: 70.189 N N N N
vg0907725198 C -> T LOC_Os09g13390.1 downstream_gene_variant ; 1837.0bp to feature; MODIFIER silent_mutation Average:29.068; most accessible tissue: Callus, score: 70.189 N N N N
vg0907725198 C -> T LOC_Os09g13380-LOC_Os09g13390 intergenic_region ; MODIFIER silent_mutation Average:29.068; most accessible tissue: Callus, score: 70.189 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907725198 NA 5.43E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725198 3.72E-06 9.63E-07 mr1444_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725198 3.13E-06 3.13E-06 mr1444_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251