Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907725133:

Variant ID: vg0907725133 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7725133
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:

CCAAACATATATTTGGTACTATTGAAGTTACTTAAATTTTATAAGGCCAAGATATATTTCGAAAAGAAAATGTAATTAATACAATAGTACTTTTTATTTA[A/C]
GATTCTGTTAGAAAAAAGTAACAGTGACAAAGTTAGCGTAATTATTAGGTTCTTGTGGTGCAACCAGTACAACGGGTTCAAATCCTAGACTTGATACATG

Reverse complement sequence

CATGTATCAAGTCTAGGATTTGAACCCGTTGTACTGGTTGCACCACAAGAACCTAATAATTACGCTAACTTTGTCACTGTTACTTTTTTCTAACAGAATC[T/G]
TAAATAAAAAGTACTATTGTATTAATTACATTTTCTTTTCGAAATATATCTTGGCCTTATAAAATTTAAGTAACTTCAATAGTACCAAATATATGTTTGG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.50%	2.70%	3.15%	52.67%	NA
All Indica	2759	15.30%	4.00%	3.88%	76.91%	NA
All Japonica	1512	89.50%	0.20%	0.53%	9.79%	NA
Aus	269	12.30%	5.90%	11.15%	70.63%	NA
Indica I	595	11.90%	1.30%	1.18%	85.55%	NA
Indica II	465	8.20%	3.90%	3.44%	84.52%	NA
Indica III	913	19.30%	6.90%	6.90%	66.92%	NA
Indica Intermediate	786	17.30%	2.50%	2.67%	77.48%	NA
Temperate Japonica	767	81.90%	0.30%	0.91%	16.95%	NA
Tropical Japonica	504	98.60%	0.00%	0.00%	1.39%	NA
Japonica Intermediate	241	94.60%	0.40%	0.41%	4.56%	NA
VI/Aromatic	96	95.80%	0.00%	0.00%	4.17%	NA
Intermediate	90	66.70%	1.10%	4.44%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907725133	A -> DEL	N	N	silent_mutation	Average:42.228; most accessible tissue: Callus, score: 57.984	N	N	N	N
vg0907725133	A -> C	LOC_Os09g13380.1	upstream_gene_variant ; 4356.0bp to feature; MODIFIER	silent_mutation	Average:42.228; most accessible tissue: Callus, score: 57.984	N	N	N	N
vg0907725133	A -> C	LOC_Os09g13390.1	downstream_gene_variant ; 1902.0bp to feature; MODIFIER	silent_mutation	Average:42.228; most accessible tissue: Callus, score: 57.984	N	N	N	N
vg0907725133	A -> C	LOC_Os09g13380-LOC_Os09g13390	intergenic_region ; MODIFIER	silent_mutation	Average:42.228; most accessible tissue: Callus, score: 57.984	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907725133	NA	4.95E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725133	NA	9.49E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725133	NA	2.90E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725133	NA	6.85E-12	mr1579	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725133	3.50E-06	9.63E-07	mr1444_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251