\
| Variant ID: vg0907725133 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7725133 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 70. )
CCAAACATATATTTGGTACTATTGAAGTTACTTAAATTTTATAAGGCCAAGATATATTTCGAAAAGAAAATGTAATTAATACAATAGTACTTTTTATTTA[A/C]
GATTCTGTTAGAAAAAAGTAACAGTGACAAAGTTAGCGTAATTATTAGGTTCTTGTGGTGCAACCAGTACAACGGGTTCAAATCCTAGACTTGATACATG
CATGTATCAAGTCTAGGATTTGAACCCGTTGTACTGGTTGCACCACAAGAACCTAATAATTACGCTAACTTTGTCACTGTTACTTTTTTCTAACAGAATC[T/G]
TAAATAAAAAGTACTATTGTATTAATTACATTTTCTTTTCGAAATATATCTTGGCCTTATAAAATTTAAGTAACTTCAATAGTACCAAATATATGTTTGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.50% | 2.70% | 3.15% | 52.67% | NA |
| All Indica | 2759 | 15.30% | 4.00% | 3.88% | 76.91% | NA |
| All Japonica | 1512 | 89.50% | 0.20% | 0.53% | 9.79% | NA |
| Aus | 269 | 12.30% | 5.90% | 11.15% | 70.63% | NA |
| Indica I | 595 | 11.90% | 1.30% | 1.18% | 85.55% | NA |
| Indica II | 465 | 8.20% | 3.90% | 3.44% | 84.52% | NA |
| Indica III | 913 | 19.30% | 6.90% | 6.90% | 66.92% | NA |
| Indica Intermediate | 786 | 17.30% | 2.50% | 2.67% | 77.48% | NA |
| Temperate Japonica | 767 | 81.90% | 0.30% | 0.91% | 16.95% | NA |
| Tropical Japonica | 504 | 98.60% | 0.00% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 94.60% | 0.40% | 0.41% | 4.56% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 66.70% | 1.10% | 4.44% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907725133 | A -> DEL | N | N | silent_mutation | Average:42.228; most accessible tissue: Callus, score: 57.984 | N | N | N | N |
| vg0907725133 | A -> C | LOC_Os09g13380.1 | upstream_gene_variant ; 4356.0bp to feature; MODIFIER | silent_mutation | Average:42.228; most accessible tissue: Callus, score: 57.984 | N | N | N | N |
| vg0907725133 | A -> C | LOC_Os09g13390.1 | downstream_gene_variant ; 1902.0bp to feature; MODIFIER | silent_mutation | Average:42.228; most accessible tissue: Callus, score: 57.984 | N | N | N | N |
| vg0907725133 | A -> C | LOC_Os09g13380-LOC_Os09g13390 | intergenic_region ; MODIFIER | silent_mutation | Average:42.228; most accessible tissue: Callus, score: 57.984 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907725133 | NA | 4.95E-14 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907725133 | NA | 9.49E-20 | mr1102 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907725133 | NA | 2.90E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907725133 | NA | 6.85E-12 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907725133 | 3.50E-06 | 9.63E-07 | mr1444_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |