\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907725133:

Variant ID: vg0907725133 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7725133
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAACATATATTTGGTACTATTGAAGTTACTTAAATTTTATAAGGCCAAGATATATTTCGAAAAGAAAATGTAATTAATACAATAGTACTTTTTATTTA[A/C]
GATTCTGTTAGAAAAAAGTAACAGTGACAAAGTTAGCGTAATTATTAGGTTCTTGTGGTGCAACCAGTACAACGGGTTCAAATCCTAGACTTGATACATG

Reverse complement sequence

CATGTATCAAGTCTAGGATTTGAACCCGTTGTACTGGTTGCACCACAAGAACCTAATAATTACGCTAACTTTGTCACTGTTACTTTTTTCTAACAGAATC[T/G]
TAAATAAAAAGTACTATTGTATTAATTACATTTTCTTTTCGAAATATATCTTGGCCTTATAAAATTTAAGTAACTTCAATAGTACCAAATATATGTTTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.50% 2.70% 3.15% 52.67% NA
All Indica  2759 15.30% 4.00% 3.88% 76.91% NA
All Japonica  1512 89.50% 0.20% 0.53% 9.79% NA
Aus  269 12.30% 5.90% 11.15% 70.63% NA
Indica I  595 11.90% 1.30% 1.18% 85.55% NA
Indica II  465 8.20% 3.90% 3.44% 84.52% NA
Indica III  913 19.30% 6.90% 6.90% 66.92% NA
Indica Intermediate  786 17.30% 2.50% 2.67% 77.48% NA
Temperate Japonica  767 81.90% 0.30% 0.91% 16.95% NA
Tropical Japonica  504 98.60% 0.00% 0.00% 1.39% NA
Japonica Intermediate  241 94.60% 0.40% 0.41% 4.56% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 66.70% 1.10% 4.44% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907725133 A -> DEL N N silent_mutation Average:42.228; most accessible tissue: Callus, score: 57.984 N N N N
vg0907725133 A -> C LOC_Os09g13380.1 upstream_gene_variant ; 4356.0bp to feature; MODIFIER silent_mutation Average:42.228; most accessible tissue: Callus, score: 57.984 N N N N
vg0907725133 A -> C LOC_Os09g13390.1 downstream_gene_variant ; 1902.0bp to feature; MODIFIER silent_mutation Average:42.228; most accessible tissue: Callus, score: 57.984 N N N N
vg0907725133 A -> C LOC_Os09g13380-LOC_Os09g13390 intergenic_region ; MODIFIER silent_mutation Average:42.228; most accessible tissue: Callus, score: 57.984 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907725133 NA 4.95E-14 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725133 NA 9.49E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725133 NA 2.90E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725133 NA 6.85E-12 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907725133 3.50E-06 9.63E-07 mr1444_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251