Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907716592:

Variant ID: vg0907716592 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7716592
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCCCGGTTATTTCACCCGGGACTAAAGATAGCGATCTTTAGTCCCGGATTGGTACTCCCGGTTTGGAAACCGGGACTAAAGGGGGGTTACGAACCGGG[A/C]
CTACAAAGGGTTTCTCCACCAGTGTGGATCCCGGAATCTGGCTTTGAAGACGGTCGCCCCCTGTACTGTTAGGGTTACTGCCTCCAGTTGTAGCATTAGC

Reverse complement sequence

GCTAATGCTACAACTGGAGGCAGTAACCCTAACAGTACAGGGGGCGACCGTCTTCAAAGCCAGATTCCGGGATCCACACTGGTGGAGAAACCCTTTGTAG[T/G]
CCCGGTTCGTAACCCCCCTTTAGTCCCGGTTTCCAAACCGGGAGTACCAATCCGGGACTAAAGATCGCTATCTTTAGTCCCGGGTGAAATAACCGGGAGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.80%	0.10%	1.69%	61.36%	NA
All Indica	2759	10.50%	0.00%	0.76%	88.69%	NA
All Japonica	1512	84.10%	0.30%	3.57%	12.04%	NA
Aus	269	10.80%	0.00%	1.49%	87.73%	NA
Indica I	595	11.90%	0.00%	0.67%	87.39%	NA
Indica II	465	6.70%	0.00%	1.51%	91.83%	NA
Indica III	913	8.80%	0.00%	0.22%	91.02%	NA
Indica Intermediate	786	13.90%	0.00%	1.02%	85.11%	NA
Temperate Japonica	767	71.60%	0.70%	6.65%	21.12%	NA
Tropical Japonica	504	98.60%	0.00%	0.00%	1.39%	NA
Japonica Intermediate	241	93.40%	0.00%	1.24%	5.39%	NA
VI/Aromatic	96	94.80%	0.00%	0.00%	5.21%	NA
Intermediate	90	65.60%	0.00%	1.11%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907716592	A -> DEL	N	N	silent_mutation	Average:6.187; most accessible tissue: Callus, score: 14.164	N	N	N	N
vg0907716592	A -> C	LOC_Os09g13360.1	downstream_gene_variant ; 3125.0bp to feature; MODIFIER	silent_mutation	Average:6.187; most accessible tissue: Callus, score: 14.164	N	N	N	N
vg0907716592	A -> C	LOC_Os09g13370.1	downstream_gene_variant ; 456.0bp to feature; MODIFIER	silent_mutation	Average:6.187; most accessible tissue: Callus, score: 14.164	N	N	N	N
vg0907716592	A -> C	LOC_Os09g13380.1	downstream_gene_variant ; 904.0bp to feature; MODIFIER	silent_mutation	Average:6.187; most accessible tissue: Callus, score: 14.164	N	N	N	N
vg0907716592	A -> C	LOC_Os09g13370-LOC_Os09g13380	intergenic_region ; MODIFIER	silent_mutation	Average:6.187; most accessible tissue: Callus, score: 14.164	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907716592	NA	1.89E-06	mr1006	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907716592	NA	1.72E-06	mr1052	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907716592	9.21E-08	4.20E-09	mr1677	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907716592	5.80E-06	5.80E-06	mr1678	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907716592	4.06E-07	4.06E-07	mr1950	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251