Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907680610:

Variant ID: vg0907680610 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7680610
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAATCGGAGCATGCCTTCTTTCCTTTTATATTTTATCCGGAAAGATTACCGAGTGCAGGGTAGTCATTAATGGTGCAGAACAATAGAACTCTTAGCTTGA[A/T]
GTTCTCCTGACCATATGCATCCCAAGTTTCCACACCTTCTTTCCAAAGAATCTCTAGATCGTTGATAACAGGCTCTAGGAATACATCGATATCATTGCCG

Reverse complement sequence

CGGCAATGATATCGATGTATTCCTAGAGCCTGTTATCAACGATCTAGAGATTCTTTGGAAAGAAGGTGTGGAAACTTGGGATGCATATGGTCAGGAGAAC[T/A]
TCAAGCTAAGAGTTCTATTGTTCTGCACCATTAATGACTACCCTGCACTCGGTAATCTTTCCGGATAAAATATAAAAGGAAAGAAGGCATGCTCCGATTG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.50%	7.80%	1.33%	2.39%	NA
All Indica	2759	97.00%	1.80%	0.51%	0.65%	NA
All Japonica	1512	71.20%	20.40%	2.84%	5.56%	NA
Aus	269	94.80%	0.00%	1.86%	3.35%	NA
Indica I	595	96.30%	2.50%	1.01%	0.17%	NA
Indica II	465	98.30%	1.10%	0.65%	0.00%	NA
Indica III	913	97.90%	1.00%	0.11%	0.99%	NA
Indica Intermediate	786	95.70%	2.80%	0.51%	1.02%	NA
Temperate Japonica	767	75.50%	8.60%	5.08%	10.82%	NA
Tropical Japonica	504	77.40%	22.60%	0.00%	0.00%	NA
Japonica Intermediate	241	44.80%	53.10%	1.66%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	10.00%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907680610	A -> DEL	N	N	silent_mutation	Average:6.84; most accessible tissue: Callus, score: 13.591	N	N	N	N
vg0907680610	A -> T	LOC_Os09g13310.1	downstream_gene_variant ; 3533.0bp to feature; MODIFIER	silent_mutation	Average:6.84; most accessible tissue: Callus, score: 13.591	N	N	N	N
vg0907680610	A -> T	LOC_Os09g13320.1	intron_variant ; MODIFIER	silent_mutation	Average:6.84; most accessible tissue: Callus, score: 13.591	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907680610	1.11E-06	NA	mr1263	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	1.11E-06	NA	mr1451	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	3.58E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	1.66E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	2.94E-06	2.93E-06	mr1286_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	2.93E-06	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	3.26E-06	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	2.41E-06	mr1633_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	5.45E-06	NA	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	5.35E-07	mr1665_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	4.03E-07	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	6.11E-06	mr1706_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	NA	6.51E-06	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907680610	8.71E-06	8.69E-06	mr1766_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251