\
| Variant ID: vg0907672928 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7672928 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 74. )
TCTTGGCCCTCATCGACTCGAGCTTTTCGTCGAATTCAGATGTCAGCTCAGCTCTTATCGACGCCCGGATCTTGGCTTCAAGGCGTGCATCTTTCTTCGC[C/T]
TTTTTGGAAGTCCGCTTCTTGTACTGCCAAGCGTAGTCTGGAAATCCATACTTCTAGGGAACAGAAGACCCAACGCCCCGTGTCTGTCCATAGTGTTCCT
AGGAACACTATGGACAGACACGGGGCGTTGGGTCTTCTGTTCCCTAGAAGTATGGATTTCCAGACTACGCTTGGCAGTACAAGAAGCGGACTTCCAAAAA[G/A]
GCGAAGAAAGATGCACGCCTTGAAGCCAAGATCCGGGCGTCGATAAGAGCTGAGCTGACATCTGAATTCGACGAAAAGCTCGAGTCGATGAGGGCCAAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.90% | 14.60% | 9.56% | 48.88% | NA |
| All Indica | 2759 | 11.00% | 5.60% | 15.04% | 68.32% | NA |
| All Japonica | 1512 | 57.30% | 29.20% | 1.79% | 11.64% | NA |
| Aus | 269 | 14.10% | 1.90% | 2.23% | 81.78% | NA |
| Indica I | 595 | 7.10% | 5.00% | 14.62% | 73.28% | NA |
| Indica II | 465 | 6.70% | 2.40% | 5.16% | 85.81% | NA |
| Indica III | 913 | 15.30% | 6.90% | 22.78% | 54.98% | NA |
| Indica Intermediate | 786 | 11.60% | 6.50% | 12.21% | 69.72% | NA |
| Temperate Japonica | 767 | 66.90% | 9.50% | 3.00% | 20.60% | NA |
| Tropical Japonica | 504 | 34.70% | 63.50% | 0.40% | 1.39% | NA |
| Japonica Intermediate | 241 | 74.30% | 20.30% | 0.83% | 4.56% | NA |
| VI/Aromatic | 96 | 32.30% | 62.50% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 36.70% | 32.20% | 3.33% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907672928 | C -> DEL | LOC_Os09g13300.1 | N | frameshift_variant | Average:9.49; most accessible tissue: Callus, score: 25.426 | N | N | N | N |
| vg0907672928 | C -> T | LOC_Os09g13300.1 | synonymous_variant ; p.Lys65Lys; LOW | synonymous_codon | Average:9.49; most accessible tissue: Callus, score: 25.426 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907672928 | NA | 6.39E-08 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | NA | 9.90E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | NA | 6.92E-11 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | NA | 7.61E-07 | mr1438 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | NA | 4.76E-07 | mr1642 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | 6.21E-06 | 6.27E-06 | mr1994 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | NA | 1.88E-09 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | NA | 2.89E-09 | mr1438_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | 4.68E-06 | 4.68E-06 | mr1438_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907672928 | NA | 2.36E-06 | mr1905_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |