\
| Variant ID: vg0907671668 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7671668 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAAGGAAGGCAACTTCTGGTGCATGCTTCTGACACCACTGCCAACTTAACCTACACACAAGATAAACGATCTTATAAGCAAGTTAAACCGATTGTTATTA[C/A]
CAGATTGAGTTGGGCGACAATACTTACAAGCAGTAGCACTTAAGGAGGCTTGTGTCCACCGCTCGGAGCCTGTAGAGGTCGAAAAGATCCTTGAAGTTGA
TCAACTTCAAGGATCTTTTCGACCTCTACAGGCTCCGAGCGGTGGACACAAGCCTCCTTAAGTGCTACTGCTTGTAAGTATTGTCGCCCAACTCAATCTG[G/T]
TAATAACAATCGGTTTAACTTGCTTATAAGATCGTTTATCTTGTGTGTAGGTTAAGTTGGCAGTGGTGTCAGAAGCATGCACCAGAAGTTGCCTTCCTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.60% | 8.60% | 1.08% | 54.72% | NA |
| All Indica | 2759 | 18.30% | 1.80% | 1.59% | 78.29% | NA |
| All Japonica | 1512 | 64.80% | 22.90% | 0.20% | 12.04% | NA |
| Aus | 269 | 19.00% | 0.00% | 1.49% | 79.55% | NA |
| Indica I | 595 | 16.60% | 2.50% | 2.02% | 78.82% | NA |
| Indica II | 465 | 10.50% | 1.10% | 1.29% | 87.10% | NA |
| Indica III | 913 | 23.20% | 1.00% | 1.10% | 74.70% | NA |
| Indica Intermediate | 786 | 18.60% | 2.50% | 2.04% | 76.84% | NA |
| Temperate Japonica | 767 | 65.60% | 12.80% | 0.39% | 21.25% | NA |
| Tropical Japonica | 504 | 75.60% | 23.00% | 0.00% | 1.39% | NA |
| Japonica Intermediate | 241 | 39.80% | 55.20% | 0.00% | 4.98% | NA |
| VI/Aromatic | 96 | 95.80% | 0.00% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 60.00% | 11.10% | 0.00% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907671668 | C -> DEL | N | N | silent_mutation | Average:6.314; most accessible tissue: Callus, score: 17.238 | N | N | N | N |
| vg0907671668 | C -> A | LOC_Os09g13310.1 | upstream_gene_variant ; 4195.0bp to feature; MODIFIER | silent_mutation | Average:6.314; most accessible tissue: Callus, score: 17.238 | N | N | N | N |
| vg0907671668 | C -> A | LOC_Os09g13300.1 | intron_variant ; MODIFIER | silent_mutation | Average:6.314; most accessible tissue: Callus, score: 17.238 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907671668 | 3.90E-06 | NA | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907671668 | 2.34E-06 | NA | mr1263 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907671668 | 2.34E-06 | NA | mr1451 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907671668 | NA | 8.11E-06 | mr1633_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |