\
| Variant ID: vg0907602051 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7602051 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.22, others allele: 0.00, population size: 63. )
CCACCGCAAACCCTAGCCGCTGACGCAATAATTCCCTTTTTCCTTTTCAAAAATAATTCATTATTGCGTCATAATTCAATTAAAATCCATATAAGTGTTT[C/T]
AATCCGATTAAATCTTCAAAAATTCATAACTAATTCATCTTAGCTCGGATTTAGTTGGTTCAAGTCTCTAAATTTTTCTAAAATTGAGGTCTACATGTTA
TAACATGTAGACCTCAATTTTAGAAAAATTTAGAGACTTGAACCAACTAAATCCGAGCTAAGATGAATTAGTTATGAATTTTTGAAGATTTAATCGGATT[G/A]
AAACACTTATATGGATTTTAATTGAATTATGACGCAATAATGAATTATTTTTGAAAAGGAAAAAGGGAATTATTGCGTCAGCGGCTAGGGTTTGCGGTGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 11.90% | 11.96% | 20.12% | NA |
| All Indica | 2759 | 35.20% | 20.20% | 17.58% | 27.00% | NA |
| All Japonica | 1512 | 92.50% | 0.10% | 0.66% | 6.75% | NA |
| Aus | 269 | 40.50% | 1.10% | 24.91% | 33.46% | NA |
| Indica I | 595 | 56.50% | 12.10% | 9.58% | 21.85% | NA |
| Indica II | 465 | 38.90% | 6.90% | 10.75% | 43.44% | NA |
| Indica III | 913 | 13.30% | 39.10% | 28.37% | 19.28% | NA |
| Indica Intermediate | 786 | 42.50% | 12.20% | 15.14% | 30.15% | NA |
| Temperate Japonica | 767 | 87.90% | 0.10% | 1.04% | 10.95% | NA |
| Tropical Japonica | 504 | 97.40% | 0.20% | 0.20% | 2.18% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.41% | 2.90% | NA |
| VI/Aromatic | 96 | 96.90% | 1.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 82.20% | 1.10% | 2.22% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907602051 | C -> DEL | N | N | silent_mutation | Average:34.517; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0907602051 | C -> T | LOC_Os09g13190.1 | upstream_gene_variant ; 2755.0bp to feature; MODIFIER | silent_mutation | Average:34.517; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0907602051 | C -> T | LOC_Os09g13190-LOC_Os09g13200 | intergenic_region ; MODIFIER | silent_mutation | Average:34.517; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907602051 | 1.95E-06 | NA | mr1008 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907602051 | 3.85E-06 | NA | mr1009 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907602051 | NA | 2.82E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907602051 | NA | 2.02E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907602051 | NA | 4.09E-06 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907602051 | NA | 7.02E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |