Search for Variation information by Variation ID:
Detailed information for vg0907577928:
| Variant ID: vg0907577928 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7577928 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GCTCCAACTCCAGGCTTCGGAACAAACCAAGCACCAATCCAAGCTGCCATGACGTGGTCACAACCAATTTTTGACCCATCCATGGCGGCTCAGCAAGTAC[C/A]
TCCAGTTGGAGCCGGGCAGCCGAATGCCATGGCCCAACCTCGCGCACAAGCTGCGATTTCGCCCTTCGCCACACCGTACCTGCAGCAGGGTGCGGTAAAC
Reverse complement sequence
GTTTACCGCACCCTGCTGCAGGTACGGTGTGGCGAAGGGCGAAATCGCAGCTTGTGCGCGAGGTTGGGCCATGGCATTCGGCTGCCCGGCTCCAACTGGA[G/T]
GTACTTGCTGAGCCGCCATGGATGGGTCAAAAATTGGTTGTGACCACGTCATGGCAGCTTGGATTGGTGCTTGGTTTGTTCCGAAGCCTGGAGTTGGAGC
Allele Frequencies:
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 4.80% | 1.06% | 2.58% | NA |
| All Indica | 2759 | 98.10% | 0.90% | 0.54% | 0.51% | NA |
| All Japonica | 1512 | 77.90% | 12.90% | 2.12% | 7.08% | NA |
| Aus | 269 | 98.90% | 0.40% | 0.74% | 0.00% | NA |
| Indica I | 595 | 97.50% | 1.30% | 1.01% | 0.17% | NA |
| Indica II | 465 | 98.70% | 0.20% | 0.65% | 0.43% | NA |
| Indica III | 913 | 98.70% | 0.50% | 0.11% | 0.66% | NA |
| Indica Intermediate | 786 | 97.50% | 1.30% | 0.64% | 0.64% | NA |
| Temperate Japonica | 767 | 88.30% | 5.20% | 1.69% | 4.82% | NA |
| Tropical Japonica | 504 | 77.00% | 15.90% | 1.59% | 5.56% | NA |
| Japonica Intermediate | 241 | 46.90% | 31.10% | 4.56% | 17.43% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 1.11% | 1.11% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907577928 | C -> DEL | LOC_Os09g13150.1 | N | frameshift_variant | Average:19.092; most accessible tissue: Minghui63 young leaf, score: 45.896 | N | N | N | N |
| vg0907577928 | C -> A | LOC_Os09g13150.1 | missense_variant ; p.Pro308His; MODERATE | nonsynonymous_codon ; P308H | Average:19.092; most accessible tissue: Minghui63 young leaf, score: 45.896 | benign  |
0.591 |
TOLERATED | 0.07 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907577928 | 2.96E-06 | NA | mr1263 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | 2.96E-06 | NA | mr1451 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | NA | 4.43E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | 1.34E-06 | 2.27E-08 | mr1263_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | NA | 2.68E-06 | mr1278_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | NA | 6.01E-06 | mr1374_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | NA | 8.51E-07 | mr1633_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | NA | 1.73E-06 | mr1665_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | NA | 1.62E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | NA | 7.38E-07 | mr1687_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907577928 | NA | 1.04E-06 | mr1706_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |