\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907498479:

Variant ID: vg0907498479 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7498479
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ACCACAGCAACGTCTTCGAGAAACCGCGAATCGACGAAACGACCGAAATCTACGCGACAAACGAAGCACACAAGCAAAACATGCTATAAGACTACTGAAA[C/T]
AGAGAACAAAATCATTTTTAATGGATTCTTTGCATTTTTTTTGATTTACTGAGACTTGAATGGACTTAAACGGAGCTCGGATGAATTACTTATGAATTTT

Reverse complement sequence

AAAATTCATAAGTAATTCATCCGAGCTCCGTTTAAGTCCATTCAAGTCTCAGTAAATCAAAAAAAATGCAAAGAATCCATTAAAAATGATTTTGTTCTCT[G/A]
TTTCAGTAGTCTTATAGCATGTTTTGCTTGTGTGCTTCGTTTGTCGCGTAGATTTCGGTCGTTTCGTCGATTCGCGGTTTCTCGAAGACGTTGCTGTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.70% 1.80% 15.09% 21.41% NA
All Indica  2759 49.40% 2.80% 21.64% 26.17% NA
All Japonica  1512 80.20% 0.60% 4.56% 14.68% NA
Aus  269 65.40% 0.00% 13.75% 20.82% NA
Indica I  595 34.10% 1.20% 23.53% 41.18% NA
Indica II  465 78.30% 0.20% 7.96% 13.55% NA
Indica III  913 43.70% 5.90% 28.37% 22.02% NA
Indica Intermediate  786 50.60% 1.80% 20.48% 27.10% NA
Temperate Japonica  767 92.30% 0.10% 1.56% 6.00% NA
Tropical Japonica  504 76.80% 1.00% 5.36% 16.87% NA
Japonica Intermediate  241 48.50% 1.20% 12.45% 37.76% NA
VI/Aromatic  96 96.90% 0.00% 2.08% 1.04% NA
Intermediate  90 78.90% 0.00% 8.89% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907498479 C -> DEL N N silent_mutation Average:24.028; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0907498479 C -> T LOC_Os09g12990.1 upstream_gene_variant ; 3047.0bp to feature; MODIFIER silent_mutation Average:24.028; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N
vg0907498479 C -> T LOC_Os09g12990-LOC_Os09g13000 intergenic_region ; MODIFIER silent_mutation Average:24.028; most accessible tissue: Zhenshan97 panicle, score: 32.308 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907498479 NA 5.31E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 6.34E-07 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 6.18E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 9.80E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 2.46E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 9.68E-07 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 4.35E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 6.51E-08 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 8.97E-06 mr1445_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 7.25E-07 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 5.31E-06 mr1449_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 1.45E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 1.75E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 9.63E-07 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 6.05E-06 mr1717_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 6.56E-07 6.56E-07 mr1755_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 1.99E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 5.17E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907498479 NA 4.85E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251