\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907494875:

Variant ID: vg0907494875 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7494875
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.90, C: 0.09, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCGATCTCCCTCCCCACTTGTTCTCCACCAAATTGAATACCAAAAATCGGTTCCTCTCCTCCTTATCATCAATTCCCCCACGTTTTCCCCTCTTAATT[T/C]
GGCCTTTAATCATCGAATTTAATCGCCGGTGAACCACCACCATTGATGACCTGCCAGCGAGCTCCCCGGCCGTTCCCCTCCTTCTCCCCGGACTACAAAA

Reverse complement sequence

TTTTGTAGTCCGGGGAGAAGGAGGGGAACGGCCGGGGAGCTCGCTGGCAGGTCATCAATGGTGGTGGTTCACCGGCGATTAAATTCGATGATTAAAGGCC[A/G]
AATTAAGAGGGGAAAACGTGGGGGAATTGATGATAAGGAGGAGAGGAACCGATTTTTGGTATTCAATTTGGTGGAGAACAAGTGGGGAGGGAGATCGGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.00% 37.60% 0.68% 0.74% NA
All Indica  2759 48.90% 49.30% 0.98% 0.80% NA
All Japonica  1512 79.40% 20.30% 0.26% 0.00% NA
Aus  269 63.20% 32.30% 0.37% 4.09% NA
Indica I  595 29.10% 67.90% 2.69% 0.34% NA
Indica II  465 75.70% 21.30% 0.65% 2.37% NA
Indica III  913 47.40% 51.70% 0.22% 0.66% NA
Indica Intermediate  786 49.70% 49.10% 0.76% 0.38% NA
Temperate Japonica  767 91.90% 7.80% 0.26% 0.00% NA
Tropical Japonica  504 76.00% 23.60% 0.40% 0.00% NA
Japonica Intermediate  241 46.90% 53.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 78.90% 18.90% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907494875 T -> DEL LOC_Os09g12990.1 N frameshift_variant Average:63.1; most accessible tissue: Minghui63 young leaf, score: 85.236 N N N N
vg0907494875 T -> C LOC_Os09g12990.1 missense_variant ; p.Gln114Arg; MODERATE nonsynonymous_codon ; Q114G Average:63.1; most accessible tissue: Minghui63 young leaf, score: 85.236 unknown unknown TOLERATED 0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907494875 NA 1.89E-06 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 3.36E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 5.11E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 1.12E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 5.42E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 3.75E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 3.99E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 8.70E-07 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 5.86E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 5.57E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 1.64E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 8.71E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 2.92E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 8.57E-06 8.57E-06 mr1690_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 4.11E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 6.70E-07 6.70E-07 mr1755_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907494875 NA 6.47E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251