\
| Variant ID: vg0907480791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7480791 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 89. )
ATTATTTTAGTGGGTGTAAATAATGGGTCTACTTAATTAAAATATATGTTGTTTTCATCTTATAACTTTTAAAAATTATATCTAATTTATTAGAATGTTA[T/C]
GTGACGGTTCATGAGTCTTCGTAGGATACCACGTGATGGTTTAGGAGTATAAATGGGATGTGTAATGGACTTTCAAGTAGATAATATAATAGATAGACTT
AAGTCTATCTATTATATTATCTACTTGAAAGTCCATTACACATCCCATTTATACTCCTAAACCATCACGTGGTATCCTACGAAGACTCATGAACCGTCAC[A/G]
TAACATTCTAATAAATTAGATATAATTTTTAAAAGTTATAAGATGAAAACAACATATATTTTAATTAAGTAGACCCATTATTTACACCCACTAAAATAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 31.40% | 0.30% | 0.57% | NA |
| All Indica | 2759 | 53.50% | 45.60% | 0.43% | 0.54% | NA |
| All Japonica | 1512 | 95.40% | 4.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 46.10% | 50.20% | 0.00% | 3.72% | NA |
| Indica I | 595 | 73.10% | 26.40% | 0.50% | 0.00% | NA |
| Indica II | 465 | 24.90% | 72.50% | 0.43% | 2.15% | NA |
| Indica III | 913 | 54.80% | 44.50% | 0.33% | 0.44% | NA |
| Indica Intermediate | 786 | 53.90% | 45.40% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 92.80% | 7.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.00% | 0.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 23.30% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907480791 | T -> DEL | N | N | silent_mutation | Average:54.932; most accessible tissue: Callus, score: 79.275 | N | N | N | N |
| vg0907480791 | T -> C | LOC_Os09g12980.1 | upstream_gene_variant ; 3760.0bp to feature; MODIFIER | silent_mutation | Average:54.932; most accessible tissue: Callus, score: 79.275 | N | N | N | N |
| vg0907480791 | T -> C | LOC_Os09g12970.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.932; most accessible tissue: Callus, score: 79.275 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907480791 | 6.42E-06 | NA | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 1.21E-06 | 4.47E-06 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 7.12E-07 | 1.01E-06 | mr1247 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 5.13E-06 | 5.56E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 1.56E-06 | 6.39E-07 | mr1693 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 4.62E-06 | 8.30E-06 | mr1720 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 1.04E-07 | 1.38E-07 | mr1917 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 9.82E-07 | 3.58E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 8.78E-08 | 2.44E-07 | mr1117_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 2.57E-06 | 3.21E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 8.03E-06 | 5.11E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | NA | 2.37E-06 | mr1322_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | NA | 3.17E-06 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | NA | 8.79E-07 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | NA | 2.07E-06 | mr1338_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | NA | 7.50E-06 | mr1445_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 4.89E-06 | 2.45E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907480791 | 8.68E-06 | 8.68E-06 | mr1755_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |