\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907480791:

Variant ID: vg0907480791 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7480791
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATTTTAGTGGGTGTAAATAATGGGTCTACTTAATTAAAATATATGTTGTTTTCATCTTATAACTTTTAAAAATTATATCTAATTTATTAGAATGTTA[T/C]
GTGACGGTTCATGAGTCTTCGTAGGATACCACGTGATGGTTTAGGAGTATAAATGGGATGTGTAATGGACTTTCAAGTAGATAATATAATAGATAGACTT

Reverse complement sequence

AAGTCTATCTATTATATTATCTACTTGAAAGTCCATTACACATCCCATTTATACTCCTAAACCATCACGTGGTATCCTACGAAGACTCATGAACCGTCAC[A/G]
TAACATTCTAATAAATTAGATATAATTTTTAAAAGTTATAAGATGAAAACAACATATATTTTAATTAAGTAGACCCATTATTTACACCCACTAAAATAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 31.40% 0.30% 0.57% NA
All Indica  2759 53.50% 45.60% 0.43% 0.54% NA
All Japonica  1512 95.40% 4.50% 0.07% 0.00% NA
Aus  269 46.10% 50.20% 0.00% 3.72% NA
Indica I  595 73.10% 26.40% 0.50% 0.00% NA
Indica II  465 24.90% 72.50% 0.43% 2.15% NA
Indica III  913 54.80% 44.50% 0.33% 0.44% NA
Indica Intermediate  786 53.90% 45.40% 0.51% 0.13% NA
Temperate Japonica  767 92.80% 7.20% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 0.80% 0.20% 0.00% NA
Japonica Intermediate  241 96.30% 3.70% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 73.30% 23.30% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907480791 T -> DEL N N silent_mutation Average:54.932; most accessible tissue: Callus, score: 79.275 N N N N
vg0907480791 T -> C LOC_Os09g12980.1 upstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:54.932; most accessible tissue: Callus, score: 79.275 N N N N
vg0907480791 T -> C LOC_Os09g12970.1 intron_variant ; MODIFIER silent_mutation Average:54.932; most accessible tissue: Callus, score: 79.275 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907480791 6.42E-06 NA mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 1.21E-06 4.47E-06 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 7.12E-07 1.01E-06 mr1247 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 5.13E-06 5.56E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 1.56E-06 6.39E-07 mr1693 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 4.62E-06 8.30E-06 mr1720 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 1.04E-07 1.38E-07 mr1917 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 9.82E-07 3.58E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 8.78E-08 2.44E-07 mr1117_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 2.57E-06 3.21E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 8.03E-06 5.11E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 NA 2.37E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 NA 3.17E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 NA 8.79E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 NA 2.07E-06 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 NA 7.50E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 4.89E-06 2.45E-06 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907480791 8.68E-06 8.68E-06 mr1755_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251