Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907448324:

Variant ID: vg0907448324 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7448324
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TCAGTCTGCACTCCACAATGAGCCATGCTATACAAAGCGTCTAGTCATTTCCCACTCTGGCTTGTGGTTAGTACTGTTAATGTTTCACAACAGTAGCTCG[C/T]
GAACTGGTCCTTAATTATCATGAGCACGACCCTCAAAATCTTGTGCTTACAACCCACCATTGTTAGGTTTTAGTTGGCAATTCATTAAATAACTAATCAC

Reverse complement sequence

GTGATTAGTTATTTAATGAATTGCCAACTAAAACCTAACAATGGTGGGTTGTAAGCACAAGATTTTGAGGGTCGTGCTCATGATAATTAAGGACCAGTTC[G/A]
CGAGCTACTGTTGTGAAACATTAACAGTACTAACCACAAGCCAGAGTGGGAAATGACTAGACGCTTTGTATAGCATGGCTCATTGTGGAGTGCAGACTGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.90%	45.30%	0.23%	0.55%	NA
All Indica	2759	39.50%	59.60%	0.36%	0.54%	NA
All Japonica	1512	78.90%	21.10%	0.00%	0.00%	NA
Aus	269	37.90%	58.40%	0.00%	3.72%	NA
Indica I	595	7.20%	92.60%	0.17%	0.00%	NA
Indica II	465	74.40%	22.60%	0.86%	2.15%	NA
Indica III	913	42.10%	57.30%	0.22%	0.44%	NA
Indica Intermediate	786	40.50%	59.00%	0.38%	0.13%	NA
Temperate Japonica	767	91.50%	8.50%	0.00%	0.00%	NA
Tropical Japonica	504	75.40%	24.60%	0.00%	0.00%	NA
Japonica Intermediate	241	46.10%	53.90%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	23.30%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907448324	C -> DEL	N	N	silent_mutation	Average:51.626; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0907448324	C -> T	LOC_Os09g12920.1	downstream_gene_variant ; 3359.0bp to feature; MODIFIER	silent_mutation	Average:51.626; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0907448324	C -> T	LOC_Os09g12930.1	downstream_gene_variant ; 3609.0bp to feature; MODIFIER	silent_mutation	Average:51.626; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N
vg0907448324	C -> T	LOC_Os09g12920-LOC_Os09g12930	intergenic_region ; MODIFIER	silent_mutation	Average:51.626; most accessible tissue: Minghui63 young leaf, score: 67.374	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907448324	NA	3.73E-07	mr1598	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	3.77E-09	mr1935	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	7.51E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	7.14E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.16E-07	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	8.51E-07	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.76E-08	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	4.70E-07	mr1321_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	3.36E-08	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.23E-09	mr1332_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	9.88E-08	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.23E-06	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.01E-07	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.88E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.37E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	4.99E-06	mr1355_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.69E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	6.01E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	8.73E-07	mr1371_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	5.54E-07	mr1449_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.95E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	6.11E-07	mr1527_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.58E-07	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.11E-06	mr1655_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.37E-06	mr1712_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	3.17E-10	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	3.57E-06	1.24E-08	mr1717_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.23E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	1.41E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.04E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	3.38E-06	mr1893_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	5.48E-08	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	3.22E-08	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	7.65E-06	mr1910_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.75E-10	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	7.73E-07	mr1946_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.75E-10	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	7.73E-07	mr1948_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907448324	NA	2.37E-09	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251