\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907433822:

Variant ID: vg0907433822 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7433822
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.95, G: 0.05, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CCTGAAGATAGTTTATAGAGAAACGAGGCAATAGCTTAGAGAGCTATAGGTACCCATATAGACATACTATTGAGGTGGTTTACTATTAATCTAGTCTATT[A/G]
TTGAGATGTACATGTTTTATAGAGAGCACTTTACTTTACCATTGCGGGTGCTCTTAGCAAGGTTGTCTCAAGAGACATTGCTTGCTACTCCCTCCATCTA

Reverse complement sequence

TAGATGGAGGGAGTAGCAAGCAATGTCTCTTGAGACAACCTTGCTAAGAGCACCCGCAATGGTAAAGTAAAGTGCTCTCTATAAAACATGTACATCTCAA[T/C]
AATAGACTAGATTAATAGTAAACCACCTCAATAGTATGTCTATATGGGTACCTATAGCTCTCTAAGCTATTGCCTCGTTTCTCTATAAACTATCTTCAGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 25.20% 0.25% 0.61% NA
All Indica  2759 57.10% 41.90% 0.36% 0.58% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 93.70% 2.20% 0.00% 4.09% NA
Indica I  595 74.10% 25.90% 0.00% 0.00% NA
Indica II  465 25.40% 72.30% 0.22% 2.15% NA
Indica III  913 59.80% 39.00% 0.77% 0.44% NA
Indica Intermediate  786 59.90% 39.60% 0.25% 0.25% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 77.80% 17.80% 2.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907433822 A -> G LOC_Os09g12900.1 upstream_gene_variant ; 4048.0bp to feature; MODIFIER silent_mutation Average:65.436; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0907433822 A -> G LOC_Os09g12910.1 upstream_gene_variant ; 4905.0bp to feature; MODIFIER silent_mutation Average:65.436; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0907433822 A -> G LOC_Os09g12900-LOC_Os09g12910 intergenic_region ; MODIFIER silent_mutation Average:65.436; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N
vg0907433822 A -> DEL N N silent_mutation Average:65.436; most accessible tissue: Minghui63 panicle, score: 87.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907433822 NA 2.04E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 1.93E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 2.47E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 3.63E-06 mr1326_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 5.11E-07 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 1.08E-13 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 6.82E-07 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 1.67E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 4.65E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 4.22E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 3.76E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 4.48E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 NA 4.80E-10 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 4.07E-06 4.06E-06 mr1755_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907433822 6.89E-07 6.89E-07 mr1755_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251