\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907430352:

Variant ID: vg0907430352 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7430352
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AATCAAGTTCACGTGGGGGTGGCGGGGTGGTAGGTCGCTGAGTTAAAAATTAACTGCGTGGTCTGCGTGGGGCAAGGGGGTTGATTGTGTCAGGCGCCAT[C/A]
TAATACGTGGCGCCTGTAATACCATATATATATATATATATATATGGTGCATTAGATACCATGGTGCCCGGGCACCATGGTGCCCCATATATATATATAT

Reverse complement sequence

ATATATATATATATGGGGCACCATGGTGCCCGGGCACCATGGTATCTAATGCACCATATATATATATATATATATATGGTATTACAGGCGCCACGTATTA[G/T]
ATGGCGCCTGACACAATCAACCCCCTTGCCCCACGCAGACCACGCAGTTAATTTTTAACTCAGCGACCTACCACCCCGCCACCCCCACGTGAACTTGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 1.10% 8.70% 33.35% NA
All Indica  2759 45.10% 1.40% 8.16% 45.31% NA
All Japonica  1512 72.20% 0.90% 11.38% 15.61% NA
Aus  269 84.00% 0.00% 2.97% 13.01% NA
Indica I  595 23.20% 1.30% 5.21% 70.25% NA
Indica II  465 75.30% 0.40% 4.30% 20.00% NA
Indica III  913 42.90% 1.60% 14.46% 40.96% NA
Indica Intermediate  786 46.40% 1.80% 5.34% 46.44% NA
Temperate Japonica  767 91.90% 0.10% 4.30% 3.65% NA
Tropical Japonica  504 57.50% 1.20% 13.29% 27.98% NA
Japonica Intermediate  241 39.80% 2.50% 29.88% 27.80% NA
VI/Aromatic  96 59.40% 0.00% 0.00% 40.62% NA
Intermediate  90 74.40% 1.10% 6.67% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907430352 C -> DEL N N silent_mutation Average:64.642; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0907430352 C -> A LOC_Os09g12900.1 upstream_gene_variant ; 578.0bp to feature; MODIFIER silent_mutation Average:64.642; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg0907430352 C -> A LOC_Os09g12900-LOC_Os09g12910 intergenic_region ; MODIFIER silent_mutation Average:64.642; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907430352 NA 3.65E-07 mr1159_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 5.74E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 2.53E-07 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 5.63E-07 mr1338_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 2.84E-07 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 2.97E-06 2.96E-06 mr1412_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 1.89E-07 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 6.15E-06 mr1445_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 8.58E-07 mr1568_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 2.72E-06 mr1647_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 1.94E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 5.59E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 1.37E-06 mr1747_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 3.15E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 9.34E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 4.95E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907430352 NA 6.48E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251