Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907386916:

Variant ID: vg0907386916 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7386916
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CCAGCAGGGAGTGGTCTCTCGGTAGTACTTGGGTGCCTGGCACTGAGTCCTATATTGTAAGCATGTATATGTTAAGTGTATACTGAACATGATTAGTATA[G/T]
AAGTACATATGAATCGTAGTTTCCTCATACTAATTCCCTACTAGATATTCTTATAGAGGTGAATCTCCTGTGTGTGTCCACTACCTTATCAATTATTATC

Reverse complement sequence

GATAATAATTGATAAGGTAGTGGACACACACAGGAGATTCACCTCTATAAGAATATCTAGTAGGGAATTAGTATGAGGAAACTACGATTCATATGTACTT[C/A]
TATACTAATCATGTTCAGTATACACTTAACATATACATGCTTACAATATAGGACTCAGTGCCAGGCACCCAAGTACTACCGAGAGACCACTCCCTGCTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.50% 16.40% 0.06% 0.00% NA
All Indica  2759 72.50% 27.50% 0.07% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 25.40% 74.40% 0.22% 0.00% NA
Indica III  913 87.60% 12.40% 0.00% 0.00% NA
Indica Intermediate  786 64.80% 35.10% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 12.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907386916 G -> T LOC_Os09g12840-LOC_Os09g12850 intergenic_region ; MODIFIER silent_mutation Average:44.002; most accessible tissue: Zhenshan97 young leaf, score: 54.618 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907386916 NA 6.05E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 6.81E-08 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 2.53E-07 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 2.28E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 3.91E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 7.43E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 5.18E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 1.21E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 9.40E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 2.00E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 9.58E-07 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 7.72E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 3.71E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 7.08E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 9.19E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 2.83E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 9.48E-06 mr1510_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 1.57E-07 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 3.36E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 3.07E-10 mr1598_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 5.27E-11 mr1715_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907386916 NA 5.23E-06 mr1768_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251