Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907362663:

Variant ID: vg0907362663 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7362663
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


AGATCTGCTATCCTCGCTGTTGTCCGGCGTCGTTGCTACCAAGGGTCCCCACCACCGGACCCGTGCAGGGAAGGGCAGCCAGCACCAGATCTATGCGGCT[G/A]
CCCGAGGTCGCTCCAGCTACCCGAGCCCGCCACCACTGCTCCCGTCGTCCTCCACATCGGATTCATCGCCGAGCTCCTTGCCACCGATCGCCGACCCGCT

Reverse complement sequence

AGCGGGTCGGCGATCGGTGGCAAGGAGCTCGGCGATGAATCCGATGTGGAGGACGACGGGAGCAGTGGTGGCGGGCTCGGGTAGCTGGAGCGACCTCGGG[C/T]
AGCCGCATAGATCTGGTGCTGGCTGCCCTTCCCTGCACGGGTCCGGTGGTGGGGACCCTTGGTAGCAACGACGCCGGACAACAGCGAGGATAGCAGATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 31.30% 0.04% 1.25% NA
All Indica  2759 95.80% 2.90% 0.07% 1.30% NA
All Japonica  1512 21.40% 78.60% 0.00% 0.00% NA
Aus  269 66.20% 25.70% 0.00% 8.18% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 93.50% 0.60% 0.00% 5.81% NA
Indica III  913 95.80% 3.50% 0.11% 0.55% NA
Indica Intermediate  786 94.30% 5.20% 0.00% 0.51% NA
Temperate Japonica  767 8.60% 91.40% 0.00% 0.00% NA
Tropical Japonica  504 24.60% 75.40% 0.00% 0.00% NA
Japonica Intermediate  241 55.60% 44.40% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 43.30% 55.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907362663 G -> DEL N N silent_mutation Average:68.179; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg0907362663 G -> A LOC_Os09g12810.1 upstream_gene_variant ; 4296.0bp to feature; MODIFIER silent_mutation Average:68.179; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N
vg0907362663 G -> A LOC_Os09g12800-LOC_Os09g12810 intergenic_region ; MODIFIER silent_mutation Average:68.179; most accessible tissue: Minghui63 young leaf, score: 85.826 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0907362663 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907362663 NA 9.82E-16 mr1323 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907362663 NA 3.61E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907362663 NA 8.52E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907362663 NA 3.89E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907362663 3.05E-06 2.44E-29 mr1323_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907362663 NA 5.87E-09 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907362663 NA 3.77E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907362663 NA 3.48E-11 mr1756_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907362663 NA 4.61E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251