\
| Variant ID: vg0907270830 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7270830 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACCTCTTTGTAGATTTGTCCTGAAAACCTTCCGTATTGCCTATGAGACAGGTTAGTTATCCTCATATCGATCTAAATCGGCTTAGAGGCTGATTTTTGAT[C/A]
TCTAAATCGGCTCCGCTAGCCGGTTTAGCTGTTTTTCTACAAAACCCATCTTGATTTGGCCGTTTGGCTAGATCGAGGTGGTTGGCGACTCCATATCACC
GGTGATATGGAGTCGCCAACCACCTCGATCTAGCCAAACGGCCAAATCAAGATGGGTTTTGTAGAAAAACAGCTAAACCGGCTAGCGGAGCCGATTTAGA[G/T]
ATCAAAAATCAGCCTCTAAGCCGATTTAGATCGATATGAGGATAACTAACCTGTCTCATAGGCAATACGGAAGGTTTTCAGGACAAATCTACAAAGAGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.10% | 1.10% | 1.38% | 3.47% | NA |
| All Indica | 2759 | 93.40% | 0.00% | 0.72% | 5.84% | NA |
| All Japonica | 1512 | 94.40% | 3.30% | 2.31% | 0.00% | NA |
| Aus | 269 | 95.50% | 0.00% | 3.72% | 0.74% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.00% | 0.17% | NA |
| Indica II | 465 | 98.30% | 0.00% | 0.00% | 1.72% | NA |
| Indica III | 913 | 85.20% | 0.00% | 1.42% | 13.36% | NA |
| Indica Intermediate | 786 | 95.30% | 0.00% | 0.89% | 3.82% | NA |
| Temperate Japonica | 767 | 89.80% | 6.10% | 4.04% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.10% | 1.20% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907270830 | C -> DEL | N | N | silent_mutation | Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0907270830 | C -> A | LOC_Os09g12710.1 | upstream_gene_variant ; 398.0bp to feature; MODIFIER | silent_mutation | Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0907270830 | C -> A | LOC_Os09g12690.1 | downstream_gene_variant ; 3450.0bp to feature; MODIFIER | silent_mutation | Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0907270830 | C -> A | LOC_Os09g12700.1 | downstream_gene_variant ; 677.0bp to feature; MODIFIER | silent_mutation | Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| vg0907270830 | C -> A | LOC_Os09g12700-LOC_Os09g12710 | intergenic_region ; MODIFIER | silent_mutation | Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907270830 | NA | 7.36E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0907270830 | NA | 8.52E-06 | mr1030_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907270830 | 2.54E-07 | 3.06E-08 | mr1060_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907270830 | 3.36E-06 | 3.36E-06 | mr1499_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907270830 | NA | 1.87E-06 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907270830 | NA | 2.37E-06 | mr1621_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907270830 | NA | 1.06E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907270830 | 4.21E-06 | 5.00E-06 | mr1821_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907270830 | NA | 8.72E-06 | mr1996_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |