\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907270830:

Variant ID: vg0907270830 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7270830
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCTCTTTGTAGATTTGTCCTGAAAACCTTCCGTATTGCCTATGAGACAGGTTAGTTATCCTCATATCGATCTAAATCGGCTTAGAGGCTGATTTTTGAT[C/A]
TCTAAATCGGCTCCGCTAGCCGGTTTAGCTGTTTTTCTACAAAACCCATCTTGATTTGGCCGTTTGGCTAGATCGAGGTGGTTGGCGACTCCATATCACC

Reverse complement sequence

GGTGATATGGAGTCGCCAACCACCTCGATCTAGCCAAACGGCCAAATCAAGATGGGTTTTGTAGAAAAACAGCTAAACCGGCTAGCGGAGCCGATTTAGA[G/T]
ATCAAAAATCAGCCTCTAAGCCGATTTAGATCGATATGAGGATAACTAACCTGTCTCATAGGCAATACGGAAGGTTTTCAGGACAAATCTACAAAGAGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 1.10% 1.38% 3.47% NA
All Indica  2759 93.40% 0.00% 0.72% 5.84% NA
All Japonica  1512 94.40% 3.30% 2.31% 0.00% NA
Aus  269 95.50% 0.00% 3.72% 0.74% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 98.30% 0.00% 0.00% 1.72% NA
Indica III  913 85.20% 0.00% 1.42% 13.36% NA
Indica Intermediate  786 95.30% 0.00% 0.89% 3.82% NA
Temperate Japonica  767 89.80% 6.10% 4.04% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 1.20% 1.66% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907270830 C -> DEL N N silent_mutation Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0907270830 C -> A LOC_Os09g12710.1 upstream_gene_variant ; 398.0bp to feature; MODIFIER silent_mutation Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0907270830 C -> A LOC_Os09g12690.1 downstream_gene_variant ; 3450.0bp to feature; MODIFIER silent_mutation Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0907270830 C -> A LOC_Os09g12700.1 downstream_gene_variant ; 677.0bp to feature; MODIFIER silent_mutation Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0907270830 C -> A LOC_Os09g12700-LOC_Os09g12710 intergenic_region ; MODIFIER silent_mutation Average:58.639; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907270830 NA 7.36E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0907270830 NA 8.52E-06 mr1030_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907270830 2.54E-07 3.06E-08 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907270830 3.36E-06 3.36E-06 mr1499_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907270830 NA 1.87E-06 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907270830 NA 2.37E-06 mr1621_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907270830 NA 1.06E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907270830 4.21E-06 5.00E-06 mr1821_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907270830 NA 8.72E-06 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251