\
| Variant ID: vg0907218440 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7218440 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTAGACGAGGCGCTGTGCTTTCAGTGGTAGACGAAGCGAGGCGCATGTGGTGACTTTGTCAATCTCTCCAGGATTTGCCGATCCAGTCTTCGAAGATACT[C/A]
ATAAGGTTCATGGGGGTGAGTGCGCGTGCGCATGTGGTGACTTTGTCAATCTCTCCAGGATTTGCCGATCCAGTCTTCGAAGATACTCATAGGATTCATA
TATGAATCCTATGAGTATCTTCGAAGACTGGATCGGCAAATCCTGGAGAGATTGACAAAGTCACCACATGCGCACGCGCACTCACCCCCATGAACCTTAT[G/T]
AGTATCTTCGAAGACTGGATCGGCAAATCCTGGAGAGATTGACAAAGTCACCACATGCGCCTCGCTTCGTCTACCACTGAAAGCACAGCGCCTCGTCTAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.50% | 1.00% | 7.45% | 54.10% | NA |
| All Indica | 2759 | 9.40% | 0.00% | 6.85% | 83.80% | NA |
| All Japonica | 1512 | 89.80% | 2.90% | 6.48% | 0.79% | NA |
| Aus | 269 | 13.40% | 0.00% | 10.78% | 75.84% | NA |
| Indica I | 595 | 6.40% | 0.00% | 3.87% | 89.75% | NA |
| Indica II | 465 | 12.50% | 0.00% | 7.10% | 80.43% | NA |
| Indica III | 913 | 9.00% | 0.00% | 6.24% | 84.78% | NA |
| Indica Intermediate | 786 | 10.20% | 0.00% | 9.67% | 80.15% | NA |
| Temperate Japonica | 767 | 83.10% | 5.30% | 11.08% | 0.52% | NA |
| Tropical Japonica | 504 | 98.80% | 0.00% | 0.00% | 1.19% | NA |
| Japonica Intermediate | 241 | 92.50% | 1.20% | 5.39% | 0.83% | NA |
| VI/Aromatic | 96 | 64.60% | 2.10% | 29.17% | 4.17% | NA |
| Intermediate | 90 | 62.20% | 1.10% | 8.89% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907218440 | C -> DEL | N | N | silent_mutation | Average:62.551; most accessible tissue: Callus, score: 80.504 | N | N | N | N |
| vg0907218440 | C -> A | LOC_Os09g12580.1 | upstream_gene_variant ; 1065.0bp to feature; MODIFIER | silent_mutation | Average:62.551; most accessible tissue: Callus, score: 80.504 | N | N | N | N |
| vg0907218440 | C -> A | LOC_Os09g12590.1 | upstream_gene_variant ; 522.0bp to feature; MODIFIER | silent_mutation | Average:62.551; most accessible tissue: Callus, score: 80.504 | N | N | N | N |
| vg0907218440 | C -> A | LOC_Os09g12600.1 | downstream_gene_variant ; 3735.0bp to feature; MODIFIER | silent_mutation | Average:62.551; most accessible tissue: Callus, score: 80.504 | N | N | N | N |
| vg0907218440 | C -> A | LOC_Os09g12600.2 | downstream_gene_variant ; 3748.0bp to feature; MODIFIER | silent_mutation | Average:62.551; most accessible tissue: Callus, score: 80.504 | N | N | N | N |
| vg0907218440 | C -> A | LOC_Os09g12580-LOC_Os09g12590 | intergenic_region ; MODIFIER | silent_mutation | Average:62.551; most accessible tissue: Callus, score: 80.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907218440 | NA | 6.85E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907218440 | NA | 4.32E-06 | mr1354_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907218440 | 1.02E-06 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907218440 | NA | 2.10E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907218440 | 3.62E-08 | NA | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907218440 | NA | 3.94E-08 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |