\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907218440:

Variant ID: vg0907218440 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7218440
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAGACGAGGCGCTGTGCTTTCAGTGGTAGACGAAGCGAGGCGCATGTGGTGACTTTGTCAATCTCTCCAGGATTTGCCGATCCAGTCTTCGAAGATACT[C/A]
ATAAGGTTCATGGGGGTGAGTGCGCGTGCGCATGTGGTGACTTTGTCAATCTCTCCAGGATTTGCCGATCCAGTCTTCGAAGATACTCATAGGATTCATA

Reverse complement sequence

TATGAATCCTATGAGTATCTTCGAAGACTGGATCGGCAAATCCTGGAGAGATTGACAAAGTCACCACATGCGCACGCGCACTCACCCCCATGAACCTTAT[G/T]
AGTATCTTCGAAGACTGGATCGGCAAATCCTGGAGAGATTGACAAAGTCACCACATGCGCCTCGCTTCGTCTACCACTGAAAGCACAGCGCCTCGTCTAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.50% 1.00% 7.45% 54.10% NA
All Indica  2759 9.40% 0.00% 6.85% 83.80% NA
All Japonica  1512 89.80% 2.90% 6.48% 0.79% NA
Aus  269 13.40% 0.00% 10.78% 75.84% NA
Indica I  595 6.40% 0.00% 3.87% 89.75% NA
Indica II  465 12.50% 0.00% 7.10% 80.43% NA
Indica III  913 9.00% 0.00% 6.24% 84.78% NA
Indica Intermediate  786 10.20% 0.00% 9.67% 80.15% NA
Temperate Japonica  767 83.10% 5.30% 11.08% 0.52% NA
Tropical Japonica  504 98.80% 0.00% 0.00% 1.19% NA
Japonica Intermediate  241 92.50% 1.20% 5.39% 0.83% NA
VI/Aromatic  96 64.60% 2.10% 29.17% 4.17% NA
Intermediate  90 62.20% 1.10% 8.89% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907218440 C -> DEL N N silent_mutation Average:62.551; most accessible tissue: Callus, score: 80.504 N N N N
vg0907218440 C -> A LOC_Os09g12580.1 upstream_gene_variant ; 1065.0bp to feature; MODIFIER silent_mutation Average:62.551; most accessible tissue: Callus, score: 80.504 N N N N
vg0907218440 C -> A LOC_Os09g12590.1 upstream_gene_variant ; 522.0bp to feature; MODIFIER silent_mutation Average:62.551; most accessible tissue: Callus, score: 80.504 N N N N
vg0907218440 C -> A LOC_Os09g12600.1 downstream_gene_variant ; 3735.0bp to feature; MODIFIER silent_mutation Average:62.551; most accessible tissue: Callus, score: 80.504 N N N N
vg0907218440 C -> A LOC_Os09g12600.2 downstream_gene_variant ; 3748.0bp to feature; MODIFIER silent_mutation Average:62.551; most accessible tissue: Callus, score: 80.504 N N N N
vg0907218440 C -> A LOC_Os09g12580-LOC_Os09g12590 intergenic_region ; MODIFIER silent_mutation Average:62.551; most accessible tissue: Callus, score: 80.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907218440 NA 6.85E-06 mr1354 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440 NA 4.32E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440 1.02E-06 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440 NA 2.10E-07 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440 3.62E-08 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907218440 NA 3.94E-08 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251