\
| Variant ID: vg0907175571 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7175571 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 99. )
TCTCTCTTACCGACTCTGATCAGTCAGTTTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTATCGTCGGAGAATCATTCTCGAAAGATAAGGCTCTT[A/G]
GACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCATGAAGTTGGAAAACTCAATTTCCGATTACACGGCTTGGTTAATACGCACA
TGTGCGTATTAACCAAGCCGTGTAATCGGAAATTGAGTTTTCCAACTTCATGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTC[T/C]
AAGAGCCTTATCTTTCGAGAATGATTCTCCGACGATAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAAACTGACTGATCAGAGTCGGTAAGAGAGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 27.70% | 4.68% | 31.21% | NA |
| All Indica | 2759 | 39.90% | 2.30% | 6.31% | 51.43% | NA |
| All Japonica | 1512 | 25.50% | 73.80% | 0.33% | 0.40% | NA |
| Aus | 269 | 61.30% | 11.20% | 13.75% | 13.75% | NA |
| Indica I | 595 | 36.30% | 1.30% | 6.55% | 55.80% | NA |
| Indica II | 465 | 29.50% | 2.20% | 7.53% | 60.86% | NA |
| Indica III | 913 | 47.40% | 1.80% | 5.70% | 45.13% | NA |
| Indica Intermediate | 786 | 40.20% | 3.80% | 6.11% | 49.87% | NA |
| Temperate Japonica | 767 | 23.50% | 75.70% | 0.52% | 0.26% | NA |
| Tropical Japonica | 504 | 17.90% | 81.50% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 47.70% | 51.50% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 39.60% | 56.20% | 3.12% | 1.04% | NA |
| Intermediate | 90 | 32.20% | 52.20% | 2.22% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907175571 | A -> G | LOC_Os09g12530.1 | upstream_gene_variant ; 4392.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175571 | A -> G | LOC_Os09g12500.1 | downstream_gene_variant ; 4185.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175571 | A -> G | LOC_Os09g12510.1 | downstream_gene_variant ; 1978.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175571 | A -> G | LOC_Os09g12520.1 | downstream_gene_variant ; 937.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175571 | A -> G | LOC_Os09g12500.2 | downstream_gene_variant ; 4185.0bp to feature; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175571 | A -> G | LOC_Os09g12510-LOC_Os09g12520 | intergenic_region ; MODIFIER | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0907175571 | A -> DEL | N | N | silent_mutation | Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907175571 | NA | 7.52E-06 | mr1971 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175571 | NA | 8.66E-06 | mr1379_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175571 | NA | 4.65E-06 | mr1409_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175571 | NA | 2.60E-06 | mr1637_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175571 | NA | 5.99E-07 | mr1649_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907175571 | 1.01E-06 | 1.01E-06 | mr1703_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |