Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907175571:

Variant ID: vg0907175571 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7175571
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCTCTTACCGACTCTGATCAGTCAGTTTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTATCGTCGGAGAATCATTCTCGAAAGATAAGGCTCTT[A/G]
GACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCATGAAGTTGGAAAACTCAATTTCCGATTACACGGCTTGGTTAATACGCACA

Reverse complement sequence

TGTGCGTATTAACCAAGCCGTGTAATCGGAAATTGAGTTTTCCAACTTCATGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTC[T/C]
AAGAGCCTTATCTTTCGAGAATGATTCTCCGACGATAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAAACTGACTGATCAGAGTCGGTAAGAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	27.70%	4.68%	31.21%	NA
All Indica	2759	39.90%	2.30%	6.31%	51.43%	NA
All Japonica	1512	25.50%	73.80%	0.33%	0.40%	NA
Aus	269	61.30%	11.20%	13.75%	13.75%	NA
Indica I	595	36.30%	1.30%	6.55%	55.80%	NA
Indica II	465	29.50%	2.20%	7.53%	60.86%	NA
Indica III	913	47.40%	1.80%	5.70%	45.13%	NA
Indica Intermediate	786	40.20%	3.80%	6.11%	49.87%	NA
Temperate Japonica	767	23.50%	75.70%	0.52%	0.26%	NA
Tropical Japonica	504	17.90%	81.50%	0.00%	0.60%	NA
Japonica Intermediate	241	47.70%	51.50%	0.41%	0.41%	NA
VI/Aromatic	96	39.60%	56.20%	3.12%	1.04%	NA
Intermediate	90	32.20%	52.20%	2.22%	13.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907175571	A -> G	LOC_Os09g12530.1	upstream_gene_variant ; 4392.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175571	A -> G	LOC_Os09g12500.1	downstream_gene_variant ; 4185.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175571	A -> G	LOC_Os09g12510.1	downstream_gene_variant ; 1978.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175571	A -> G	LOC_Os09g12520.1	downstream_gene_variant ; 937.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175571	A -> G	LOC_Os09g12500.2	downstream_gene_variant ; 4185.0bp to feature; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175571	A -> G	LOC_Os09g12510-LOC_Os09g12520	intergenic_region ; MODIFIER	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N
vg0907175571	A -> DEL	N	N	silent_mutation	Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907175571	NA	7.52E-06	mr1971	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571	NA	8.66E-06	mr1379_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571	NA	4.65E-06	mr1409_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571	NA	2.60E-06	mr1637_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571	NA	5.99E-07	mr1649_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571	1.01E-06	1.01E-06	mr1703_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251