\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907175571:

Variant ID: vg0907175571 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7175571
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCTTACCGACTCTGATCAGTCAGTTTGTAGAGTCATACACTCTCCCTAGCCCCCAGCCTTATCGTCGGAGAATCATTCTCGAAAGATAAGGCTCTT[A/G]
GACCTTTGACCTGCCTCGGTTGAACAAGCACTGATCCTAGCCCCCAGCCATGAAGTTGGAAAACTCAATTTCCGATTACACGGCTTGGTTAATACGCACA

Reverse complement sequence

TGTGCGTATTAACCAAGCCGTGTAATCGGAAATTGAGTTTTCCAACTTCATGGCTGGGGGCTAGGATCAGTGCTTGTTCAACCGAGGCAGGTCAAAGGTC[T/C]
AAGAGCCTTATCTTTCGAGAATGATTCTCCGACGATAAGGCTGGGGGCTAGGGAGAGTGTATGACTCTACAAACTGACTGATCAGAGTCGGTAAGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 27.70% 4.68% 31.21% NA
All Indica  2759 39.90% 2.30% 6.31% 51.43% NA
All Japonica  1512 25.50% 73.80% 0.33% 0.40% NA
Aus  269 61.30% 11.20% 13.75% 13.75% NA
Indica I  595 36.30% 1.30% 6.55% 55.80% NA
Indica II  465 29.50% 2.20% 7.53% 60.86% NA
Indica III  913 47.40% 1.80% 5.70% 45.13% NA
Indica Intermediate  786 40.20% 3.80% 6.11% 49.87% NA
Temperate Japonica  767 23.50% 75.70% 0.52% 0.26% NA
Tropical Japonica  504 17.90% 81.50% 0.00% 0.60% NA
Japonica Intermediate  241 47.70% 51.50% 0.41% 0.41% NA
VI/Aromatic  96 39.60% 56.20% 3.12% 1.04% NA
Intermediate  90 32.20% 52.20% 2.22% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907175571 A -> G LOC_Os09g12530.1 upstream_gene_variant ; 4392.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175571 A -> G LOC_Os09g12500.1 downstream_gene_variant ; 4185.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175571 A -> G LOC_Os09g12510.1 downstream_gene_variant ; 1978.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175571 A -> G LOC_Os09g12520.1 downstream_gene_variant ; 937.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175571 A -> G LOC_Os09g12500.2 downstream_gene_variant ; 4185.0bp to feature; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175571 A -> G LOC_Os09g12510-LOC_Os09g12520 intergenic_region ; MODIFIER silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg0907175571 A -> DEL N N silent_mutation Average:11.864; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907175571 NA 7.52E-06 mr1971 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571 NA 8.66E-06 mr1379_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571 NA 4.65E-06 mr1409_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571 NA 2.60E-06 mr1637_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571 NA 5.99E-07 mr1649_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907175571 1.01E-06 1.01E-06 mr1703_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251