\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907140746:

Variant ID: vg0907140746 (JBrowse)Variation Type: INDEL
Chromosome: chr09Position: 7140746
Reference Allele: GAlternative Allele: C,T,GC,GTTGC
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGCACATGCAGAGATGCTCAGTGAGTCTCCACTGAGTTTCTTAACTTTCTGAATTTGCTTGAGCTGATCGCTTCCTTGAGTTGCATTGTTGTTGTTG[G/C,T,GC,GTTGC]
TGCTGGTGTTATTGTTGTGGTAGATGGCTTGCACATTCAGAAAGATGTTAAGCGCCGCATTGAAAAGCAGAGCCGCGCATGTGGCCATGACCGCGGCAGA

Reverse complement sequence

TCTGCCGCGGTCATGGCCACATGCGCGGCTCTGCTTTTCAATGCGGCGCTTAACATCTTTCTGAATGTGCAAGCCATCTACCACAACAATAACACCAGCA[C/G,A,GC,GCAAC]
CAACAACAACAATGCAACTCAAGGAAGCGATCAGCTCAAGCAAATTCAGAAAGTTAAGAAACTCAGTGGAGACTCACTGAGCATCTCTGCATGTGCCATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.90% 26.40% 0.17% 0.28% GC: 0.19%; T: 0.08%
All Indica  2759 68.90% 30.20% 0.18% 0.36% GC: 0.25%; T: 0.11%
All Japonica  1512 87.20% 12.80% 0.00% 0.00% NA
Aus  269 21.90% 76.60% 0.37% 0.37% GC: 0.37%; T: 0.37%
Indica I  595 49.10% 49.90% 0.17% 0.67% T: 0.17%
Indica II  465 90.80% 9.00% 0.00% 0.22% NA
Indica III  913 66.20% 33.00% 0.11% 0.00% GC: 0.66%; T: 0.11%
Indica Intermediate  786 74.00% 24.70% 0.38% 0.64% T: 0.13%; GC: 0.13%
Temperate Japonica  767 97.30% 2.70% 0.00% 0.00% NA
Tropical Japonica  504 83.90% 16.10% 0.00% 0.00% NA
Japonica Intermediate  241 61.80% 38.20% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 3.10% 0.00% 1.04% GC: 1.04%
Intermediate  90 84.40% 12.20% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907140746 G -> T LOC_Os09g12480.1 N nonsynonymous_codon ; T899N Average:80.271; most accessible tissue: Zhenshan97 panicle, score: 88.35 unknown unknown TOLERATED 0.18
vg0907140746 G -> DEL LOC_Os09g12480.1 N frameshift_variant Average:80.271; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0907140746 G -> GC LOC_Os09g12480.1 frameshift_variant ; p.Thr899fs; HIGH frameshift_variant Average:80.271; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N
vg0907140746 G -> C LOC_Os09g12480.1 missense_variant ; p.Thr899Ser; MODERATE nonsynonymous_codon ; T899S Average:80.271; most accessible tissue: Zhenshan97 panicle, score: 88.35 unknown unknown TOLERATED 0.65
vg0907140746 G -> GTTGC LOC_Os09g12480.1 frameshift_variant ; p.Thr899fs; HIGH N Average:80.271; most accessible tissue: Zhenshan97 panicle, score: 88.35 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0907140746 G C -0.01 -0.01 -0.01 -0.01 0.0 0.0
vg0907140746 G GC 0.05 0.06 0.04 -0.05 -0.09 -0.17
vg0907140746 G GTTGC -0.11 0.01 -0.05 -0.25 -0.35 -0.49
vg0907140746 G T -0.04 -0.02 -0.02 -0.03 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907140746 NA 1.09E-10 mr1180 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907140746 NA 2.84E-13 mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251