Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907121871:

Variant ID: vg0907121871 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 7121871
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCAGTCCCAACCCTCCACCTAGGATGATGTCTATGGCATTAACTATATTGTCATGTAGGACTTTTAACTTATGTGGCACTATATTAATTAAGAGAGAGA[G/A]
TAAAGAGAAGAAGAAACTGAGTCTCATGCAAGACACAGCTTCAACACGAGAACCTATACACTAGACACTATCAAGTTTTGTATTGGGAGATAATAGTGTC

Reverse complement sequence

GACACTATTATCTCCCAATACAAAACTTGATAGTGTCTAGTGTATAGGTTCTCGTGTTGAAGCTGTGTCTTGCATGAGACTCAGTTTCTTCTTCTCTTTA[C/T]
TCTCTCTCTTAATTAATATAGTGCCACATAAGTTAAAAGTCCTACATGACAATATAGTTAATGCCATAGACATCATCCTAGGTGGAGGGTTGGGACTGCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	1.00%	1.31%	9.12%	NA
All Indica	2759	89.20%	0.00%	0.83%	9.97%	NA
All Japonica	1512	84.70%	3.00%	2.45%	9.79%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	98.80%	0.00%	0.17%	1.01%	NA
Indica II	465	97.20%	0.00%	0.00%	2.80%	NA
Indica III	913	72.80%	0.00%	1.97%	25.19%	NA
Indica Intermediate	786	96.20%	0.00%	0.51%	3.31%	NA
Temperate Japonica	767	96.90%	0.00%	1.83%	1.30%	NA
Tropical Japonica	504	75.40%	8.70%	2.78%	13.10%	NA
Japonica Intermediate	241	65.60%	0.80%	3.73%	29.88%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	2.20%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0907121871	G -> DEL	N	N	silent_mutation	Average:43.863; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0907121871	G -> A	LOC_Os09g12430.1	upstream_gene_variant ; 4413.0bp to feature; MODIFIER	silent_mutation	Average:43.863; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0907121871	G -> A	LOC_Os09g12440.1	upstream_gene_variant ; 1260.0bp to feature; MODIFIER	silent_mutation	Average:43.863; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0907121871	G -> A	LOC_Os09g12450.1	downstream_gene_variant ; 1845.0bp to feature; MODIFIER	silent_mutation	Average:43.863; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N
vg0907121871	G -> A	LOC_Os09g12440-LOC_Os09g12450	intergenic_region ; MODIFIER	silent_mutation	Average:43.863; most accessible tissue: Zhenshan97 root, score: 77.09	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0907121871	NA	2.86E-07	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	5.99E-06	1.36E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	1.92E-06	1.92E-06	mr1204	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	NA	2.34E-08	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	1.45E-11	1.45E-11	mr1076_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	3.04E-06	6.50E-10	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	6.67E-08	4.25E-12	mr1083_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	6.94E-07	1.04E-06	mr1085_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	6.42E-07	1.96E-08	mr1103_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	7.23E-06	8.96E-08	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	4.59E-07	3.49E-08	mr1107_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	3.72E-06	3.72E-06	mr1145_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	1.22E-08	1.01E-11	mr1226_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907121871	1.13E-06	2.63E-09	mr1408_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251