\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0907071077:

Variant ID: vg0907071077 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 7071077
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.68, G: 0.32, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGCGTGCGTCAACTTTCGCCTTTTTCGTTGCCCTTGTGGGGGCAGGTGGTGGAGCTTGGGGGGCCCTTGACTTGGAAGGTGCCGGACGAGGAGCTTGC[A/G]
GAGGAGTCAGTGTAGGAGCCTAAGGAGGAGTCGATGCAGGAGCCTAAGGTGGAGACGGTGCTGGAGCATGAGGAGGAGACGGTGCAGCAGCCTGAGGAGG

Reverse complement sequence

CCTCCTCAGGCTGCTGCACCGTCTCCTCCTCATGCTCCAGCACCGTCTCCACCTTAGGCTCCTGCATCGACTCCTCCTTAGGCTCCTACACTGACTCCTC[T/C]
GCAAGCTCCTCGTCCGGCACCTTCCAAGTCAAGGGCCCCCCAAGCTCCACCACCTGCCCCCACAAGGGCAACGAAAAAGGCGAAAGTTGACGCACGCAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 29.70% 0.57% 11.53% NA
All Indica  2759 86.80% 1.80% 0.51% 10.87% NA
All Japonica  1512 1.60% 81.90% 0.79% 15.67% NA
Aus  269 97.80% 1.10% 0.00% 1.12% NA
Indica I  595 96.10% 1.70% 0.34% 1.85% NA
Indica II  465 95.70% 1.30% 0.00% 3.01% NA
Indica III  913 71.20% 1.20% 0.88% 26.73% NA
Indica Intermediate  786 92.70% 2.80% 0.51% 3.94% NA
Temperate Japonica  767 0.50% 96.50% 0.13% 2.87% NA
Tropical Japonica  504 2.20% 70.00% 1.98% 25.79% NA
Japonica Intermediate  241 3.70% 60.60% 0.41% 35.27% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 38.90% 54.40% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0907071077 A -> G LOC_Os09g12370.1 intron_variant ; MODIFIER silent_mutation Average:44.582; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0907071077 A -> DEL N N silent_mutation Average:44.582; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0907071077 NA 2.15E-12 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 2.19E-35 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 8.07E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 8.38E-12 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 8.46E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 8.56E-19 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 7.51E-09 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 1.88E-19 mr1323 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 9.95E-09 mr1332 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 3.04E-31 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 8.24E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 5.20E-11 mr1336 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 4.86E-07 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 3.80E-13 mr1386 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 1.40E-28 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 2.56E-09 mr1442 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 1.09E-09 mr1575 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 5.30E-13 mr1579 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 3.11E-37 mr1601 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 9.70E-34 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 1.05E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 6.63E-27 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 6.53E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 2.94E-14 mr1701 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 9.33E-20 mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 3.96E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 3.76E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 5.47E-07 mr1810 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 3.98E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 1.29E-23 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 3.24E-13 mr1128_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 2.33E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 8.60E-27 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 1.81E-20 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 5.67E-06 mr1438_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0907071077 NA 1.58E-15 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251