\
| Variant ID: vg0907053460 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 7053460 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TGAATTATCCCGTGGTACGTACGTACTGTACTGTAGTATATGTGTCTACTCCTGTTTATTACAAGTCGTTTTGACTTTGGTTAAAGTTAAATTACTTCAA[G/A]
TTTAATCAAGTTTGTATATAGATATAGTAATATTTACAATATCAAGTTAGTTTCATTAAATCTATAATTGAATATGCATTCATAAGATATTTGTGTTGGG
CCCAACACAAATATCTTATGAATGCATATTCAATTATAGATTTAATGAAACTAACTTGATATTGTAAATATTACTATATCTATATACAAACTTGATTAAA[C/T]
TTGAAGTAATTTAACTTTAACCAAAGTCAAAACGACTTGTAATAAACAGGAGTAGACACATATACTACAGTACAGTACGTACGTACCACGGGATAATTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.10% | 6.80% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 96.20% | 3.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 20.80% | 79.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.90% | 6.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 96.90% | 3.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0907053460 | G -> A | LOC_Os09g12350.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.921; most accessible tissue: Callus, score: 78.478 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0907053460 | NA | 1.32E-21 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 4.66E-14 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 3.16E-18 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 2.05E-09 | mr1348 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 5.51E-10 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 2.46E-25 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 2.32E-25 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 1.33E-25 | mr1868 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 2.77E-17 | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 1.99E-21 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 8.58E-15 | mr1193_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0907053460 | NA | 1.48E-15 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |