\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906997533:

Variant ID: vg0906997533 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6997533
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTTCCCTTACCCCTTTCCACACAGTAGCCCCCCGGAGGCGCACCATGTCCGACGTTCGGTCGCCTCGAGCACTCGGCGTCAGCAGGACACCGAGCTCGC[C/T]
GCAGCAGAAGAGCGCAGGCGAGCAACGGCTCAGACTGCTGCAGCAGCAGCGAGGGCGGCCAGACTGGCGGCAGCGAAGTTGGCAGCAGCCAGGGCGGAGG

Reverse complement sequence

CCTCCGCCCTGGCTGCTGCCAACTTCGCTGCCGCCAGTCTGGCCGCCCTCGCTGCTGCTGCAGCAGTCTGAGCCGTTGCTCGCCTGCGCTCTTCTGCTGC[G/A]
GCGAGCTCGGTGTCCTGCTGACGCCGAGTGCTCGAGGCGACCGAACGTCGGACATGGTGCGCCTCCGGGGGGCTACTGTGTGGAAAGGGGTAAGGGAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.70% 20.10% 0.19% 0.00% NA
All Indica  2759 74.70% 25.00% 0.29% 0.00% NA
All Japonica  1512 98.70% 1.30% 0.07% 0.00% NA
Aus  269 28.60% 71.40% 0.00% 0.00% NA
Indica I  595 78.00% 22.00% 0.00% 0.00% NA
Indica II  465 95.50% 4.50% 0.00% 0.00% NA
Indica III  913 56.70% 42.50% 0.77% 0.00% NA
Indica Intermediate  786 80.90% 19.00% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.20% 0.60% 0.20% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 59.40% 40.60% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906997533 C -> T LOC_Os09g12270.1 downstream_gene_variant ; 3060.0bp to feature; MODIFIER silent_mutation Average:78.681; most accessible tissue: Zhenshan97 flower, score: 91.191 N N N N
vg0906997533 C -> T LOC_Os09g12290.1 intron_variant ; MODIFIER silent_mutation Average:78.681; most accessible tissue: Zhenshan97 flower, score: 91.191 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0906997533 C T -0.01 -0.01 -0.01 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906997533 NA 2.90E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 2.71E-07 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 1.85E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 3.74E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 6.09E-08 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 7.83E-07 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 6.25E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 7.98E-08 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 2.16E-06 2.16E-06 mr1421 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 5.76E-16 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 4.33E-06 mr1496 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 9.59E-09 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 3.86E-07 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 3.33E-12 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 1.07E-18 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 4.74E-06 mr1972 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 1.24E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906997533 NA 5.36E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251