| Variant ID: vg0906972834 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6972834 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AAAATATTTTTTTAATATTTTTACTAGCTTAGCTACTCTAAAGTGTTTCTTAGAATCTCACAAGTTATTTCTAGCGATAGAAATTTATGAATCTGGATCC[G/A]
TGGTAATATTTGGTTGAATCAGTTATTTCTATTTTAAGTAAATATAATTATTAAAACCATTTTAATGTATATGTACAAGCACTAACTACACGATCGATTT
AAATCGATCGTGTAGTTAGTGCTTGTACATATACATTAAAATGGTTTTAATAATTATATTTACTTAAAATAGAAATAACTGATTCAACCAAATATTACCA[C/T]
GGATCCAGATTCATAAATTTCTATCGCTAGAAATAACTTGTGAGATTCTAAGAAACACTTTAGAGTAGCTAAGCTAGTAAAAATATTAAAAAAATATTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 98.80% | 1.10% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.40% | 3.40% | 0.26% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.10% | 6.40% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906972834 | G -> A | LOC_Os09g12250.1 | upstream_gene_variant ; 2660.0bp to feature; MODIFIER | silent_mutation | Average:50.511; most accessible tissue: Callus, score: 82.315 | N | N | N | N |
| vg0906972834 | G -> A | LOC_Os09g12240-LOC_Os09g12250 | intergenic_region ; MODIFIER | silent_mutation | Average:50.511; most accessible tissue: Callus, score: 82.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906972834 | NA | 3.22E-08 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906972834 | NA | 4.71E-08 | mr1305 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906972834 | NA | 8.22E-06 | mr1379 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906972834 | NA | 1.58E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906972834 | NA | 7.32E-09 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906972834 | 4.10E-06 | 4.10E-06 | mr1649 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906972834 | NA | 4.34E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |