\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906931088:

Variant ID: vg0906931088 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6931088
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATTTCCTAAATATAAAGCATGGCTGGATTTAATTTTTATTAAATTCTCCGTGATTAATTATACTCTCTAGAATGTTCTTGAATTTTTCAGAGCTCAA[T/C]
TATTAATTTTAATAATACAAAGAACATTTCAGTAATTATTTAAATAATAAATTAATCATTAAATGATCTGTATATTATTATATTAAATACTTTGAGTGTC

Reverse complement sequence

GACACTCAAAGTATTTAATATAATAATATACAGATCATTTAATGATTAATTTATTATTTAAATAATTACTGAAATGTTCTTTGTATTATTAAAATTAATA[A/G]
TTGAGCTCTGAAAAATTCAAGAACATTCTAGAGAGTATAATTAATCACGGAGAATTTAATAAAAATTAAATCCAGCCATGCTTTATATTTAGGAAATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 9.00% 1.12% 11.24% NA
All Indica  2759 82.60% 15.00% 0.94% 1.45% NA
All Japonica  1512 73.00% 0.10% 1.32% 25.53% NA
Aus  269 72.10% 1.50% 1.12% 25.28% NA
Indica I  595 91.60% 4.20% 1.68% 2.52% NA
Indica II  465 95.90% 2.80% 1.29% 0.00% NA
Indica III  913 64.60% 33.60% 0.44% 1.31% NA
Indica Intermediate  786 88.90% 8.70% 0.76% 1.65% NA
Temperate Japonica  767 72.90% 0.00% 2.48% 24.64% NA
Tropical Japonica  504 69.00% 0.40% 0.20% 30.36% NA
Japonica Intermediate  241 81.70% 0.00% 0.00% 18.26% NA
VI/Aromatic  96 62.50% 2.10% 3.12% 32.29% NA
Intermediate  90 85.60% 6.70% 1.11% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906931088 T -> DEL N N silent_mutation Average:32.258; most accessible tissue: Zhenshan97 flower, score: 48.393 N N N N
vg0906931088 T -> C LOC_Os09g12220.1 downstream_gene_variant ; 1283.0bp to feature; MODIFIER silent_mutation Average:32.258; most accessible tissue: Zhenshan97 flower, score: 48.393 N N N N
vg0906931088 T -> C LOC_Os09g12220-LOC_Os09g12230 intergenic_region ; MODIFIER silent_mutation Average:32.258; most accessible tissue: Zhenshan97 flower, score: 48.393 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906931088 NA 7.37E-06 mr1336 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906931088 NA 1.03E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906931088 NA 7.63E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906931088 NA 6.87E-06 mr1454_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906931088 NA 2.65E-06 mr1646_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906931088 3.69E-06 NA mr1805_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251