\
| Variant ID: vg0906931088 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6931088 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAATTTCCTAAATATAAAGCATGGCTGGATTTAATTTTTATTAAATTCTCCGTGATTAATTATACTCTCTAGAATGTTCTTGAATTTTTCAGAGCTCAA[T/C]
TATTAATTTTAATAATACAAAGAACATTTCAGTAATTATTTAAATAATAAATTAATCATTAAATGATCTGTATATTATTATATTAAATACTTTGAGTGTC
GACACTCAAAGTATTTAATATAATAATATACAGATCATTTAATGATTAATTTATTATTTAAATAATTACTGAAATGTTCTTTGTATTATTAAAATTAATA[A/G]
TTGAGCTCTGAAAAATTCAAGAACATTCTAGAGAGTATAATTAATCACGGAGAATTTAATAAAAATTAAATCCAGCCATGCTTTATATTTAGGAAATTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.60% | 9.00% | 1.12% | 11.24% | NA |
| All Indica | 2759 | 82.60% | 15.00% | 0.94% | 1.45% | NA |
| All Japonica | 1512 | 73.00% | 0.10% | 1.32% | 25.53% | NA |
| Aus | 269 | 72.10% | 1.50% | 1.12% | 25.28% | NA |
| Indica I | 595 | 91.60% | 4.20% | 1.68% | 2.52% | NA |
| Indica II | 465 | 95.90% | 2.80% | 1.29% | 0.00% | NA |
| Indica III | 913 | 64.60% | 33.60% | 0.44% | 1.31% | NA |
| Indica Intermediate | 786 | 88.90% | 8.70% | 0.76% | 1.65% | NA |
| Temperate Japonica | 767 | 72.90% | 0.00% | 2.48% | 24.64% | NA |
| Tropical Japonica | 504 | 69.00% | 0.40% | 0.20% | 30.36% | NA |
| Japonica Intermediate | 241 | 81.70% | 0.00% | 0.00% | 18.26% | NA |
| VI/Aromatic | 96 | 62.50% | 2.10% | 3.12% | 32.29% | NA |
| Intermediate | 90 | 85.60% | 6.70% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906931088 | T -> DEL | N | N | silent_mutation | Average:32.258; most accessible tissue: Zhenshan97 flower, score: 48.393 | N | N | N | N |
| vg0906931088 | T -> C | LOC_Os09g12220.1 | downstream_gene_variant ; 1283.0bp to feature; MODIFIER | silent_mutation | Average:32.258; most accessible tissue: Zhenshan97 flower, score: 48.393 | N | N | N | N |
| vg0906931088 | T -> C | LOC_Os09g12220-LOC_Os09g12230 | intergenic_region ; MODIFIER | silent_mutation | Average:32.258; most accessible tissue: Zhenshan97 flower, score: 48.393 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906931088 | NA | 7.37E-06 | mr1336 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906931088 | NA | 1.03E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906931088 | NA | 7.63E-06 | mr1692 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906931088 | NA | 6.87E-06 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906931088 | NA | 2.65E-06 | mr1646_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906931088 | 3.69E-06 | NA | mr1805_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |