\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906912896:

Variant ID: vg0906912896 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6912896
Reference Allele: CAlternative Allele: T,A,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TCATCACTAAGCATATCATACATAATCAAGAGCAGCCCCAAAATGCAGTACATATGTGATGGATGGCGGCATGTTCTATGTTGCGTGCTGACTGTAAGGG[C/T,A,G]
AATCCTAACCCATGGTGTCTATAGATAGTGTCTAGACAACAGAAACAATAATAAATGTATGTAGACACTACCTCTCCAATGCATAGTGTCTATAGCAGTT

Reverse complement sequence

AACTGCTATAGACACTATGCATTGGAGAGGTAGTGTCTACATACATTTATTATTGTTTCTGTTGTCTAGACACTATCTATAGACACCATGGGTTAGGATT[G/A,T,C]
CCCTTACAGTCAGCACGCAACATAGAACATGCCGCCATCCATCACATATGTACTGCATTTTGGGGCTGCTCTTGATTATGTATGATATGCTTAGTGATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 2.40% 0.06% 0.00% G: 0.06%; A: 0.02%
All Indica  2759 99.90% 0.00% 0.00% 0.00% G: 0.11%
All Japonica  1512 92.30% 7.50% 0.20% 0.00% A: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.00% 0.00% 0.00% G: 0.11%
Indica Intermediate  786 99.70% 0.00% 0.00% 0.00% G: 0.25%
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 78.20% 21.40% 0.20% 0.00% A: 0.20%
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906912896 C -> G LOC_Os09g12200-LOC_Os09g12210 intergenic_region ; MODIFIER silent_mutation Average:74.089; most accessible tissue: Zhenshan97 panicle, score: 91.845 N N N N
vg0906912896 C -> T LOC_Os09g12200-LOC_Os09g12210 intergenic_region ; MODIFIER silent_mutation Average:74.089; most accessible tissue: Zhenshan97 panicle, score: 91.845 N N N N
vg0906912896 C -> A LOC_Os09g12200-LOC_Os09g12210 intergenic_region ; MODIFIER silent_mutation Average:74.089; most accessible tissue: Zhenshan97 panicle, score: 91.845 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0906912896 C A -0.04 -0.03 -0.02 -0.1 -0.07 -0.07
vg0906912896 C G -0.02 -0.01 -0.02 -0.07 -0.04 -0.02
vg0906912896 C T -0.02 -0.01 -0.01 -0.05 -0.07 -0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906912896 NA 6.24E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 1.96E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 6.56E-08 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 6.70E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 3.88E-07 3.88E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 1.37E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 9.47E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 1.68E-10 mr1364_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 3.14E-06 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 7.22E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 1.10E-07 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 NA 9.12E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906912896 4.45E-06 4.45E-06 mr1846_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251