| Variant ID: vg0906884682 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6884682 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTGCTCCTCATCCGACTCCTGTACGTGTGGATGTCCTTGAACCCAATCTTCCAAGGAATCACCCCTTTCCCTCGTGGTCGTCCTGGATGCTCTGGAGTCT[G/A]
CAGGGCGAGTGACAGCTCGTCCCTCTCTCTGTTCGGTCGGAACGTGCCCTGAGAAGAGGTTTCCACTGCGTCTGTTAGTCGACGCGCAGCCTCTTGTATC
GATACAAGAGGCTGCGCGTCGACTAACAGACGCAGTGGAAACCTCTTCTCAGGGCACGTTCCGACCGAACAGAGAGAGGGACGAGCTGTCACTCGCCCTG[C/T]
AGACTCCAGAGCATCCAGGACGACCACGAGGGAAAGGGGTGATTCCTTGGAAGATTGGGTTCAAGGACATCCACACGTACAGGAGTCGGATGAGGAGCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.80% | 7.90% | 3.11% | 6.22% | NA |
| All Indica | 2759 | 83.30% | 1.10% | 5.11% | 10.44% | NA |
| All Japonica | 1512 | 89.20% | 10.30% | 0.26% | 0.20% | NA |
| Aus | 269 | 66.90% | 32.00% | 0.74% | 0.37% | NA |
| Indica I | 595 | 95.50% | 0.20% | 1.18% | 3.19% | NA |
| Indica II | 465 | 97.00% | 0.20% | 1.08% | 1.72% | NA |
| Indica III | 913 | 65.70% | 1.80% | 10.95% | 21.58% | NA |
| Indica Intermediate | 786 | 86.50% | 1.70% | 3.69% | 8.14% | NA |
| Temperate Japonica | 767 | 90.00% | 9.90% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 90.50% | 8.50% | 0.60% | 0.40% | NA |
| Japonica Intermediate | 241 | 84.20% | 15.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906884682 | G -> DEL | LOC_Os09g12170.1 | N | frameshift_variant | Average:34.337; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| vg0906884682 | G -> A | LOC_Os09g12170.1 | stop_gained ; p.Gln84*; HIGH | stop_gained | Average:34.337; most accessible tissue: Minghui63 flag leaf, score: 72.907 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906884682 | 5.10E-07 | 5.10E-07 | mr1098 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906884682 | 8.30E-06 | 1.58E-06 | mr1936 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906884682 | NA | 4.45E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906884682 | 6.62E-06 | 1.83E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906884682 | NA | 6.34E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906884682 | NA | 4.22E-06 | mr1150_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906884682 | NA | 9.26E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906884682 | NA | 3.93E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |