\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906802658:

Variant ID: vg0906802658 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6802658
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


AATTCATTGTTTCTTGTCATGAGTGCATTGAAAAATTGGGATGGTGAGGGCTCGAACAATGTAGAAGTTGTGTCGGGGTATATATAAAGAATGGCAATGA[A/G]
TTGAACAAGATAGAATTCAATACCATATAACAATAATGATACTGGATTGGCACACCGGAAATTCACAACGGCCAGACTCGAAGTCTCTTTTAAGGCATGA

Reverse complement sequence

TCATGCCTTAAAAGAGACTTCGAGTCTGGCCGTTGTGAATTTCCGGTGTGCCAATCCAGTATCATTATTGTTATATGGTATTGAATTCTATCTTGTTCAA[T/C]
TCATTGCCATTCTTTATATATACCCCGACACAACTTCTACATTGTTCGAGCCCTCACCATCCCAATTTTTCAATGCACTCATGACAAGAAACAATGAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 29.70% 0.66% 35.72% NA
All Indica  2759 4.20% 35.60% 1.01% 59.19% NA
All Japonica  1512 86.50% 13.20% 0.00% 0.33% NA
Aus  269 33.80% 55.40% 0.37% 10.41% NA
Indica I  595 2.00% 34.60% 0.67% 62.69% NA
Indica II  465 8.40% 22.80% 1.51% 67.31% NA
Indica III  913 2.70% 42.70% 0.77% 53.78% NA
Indica Intermediate  786 5.10% 35.60% 1.27% 58.02% NA
Temperate Japonica  767 95.70% 4.20% 0.00% 0.13% NA
Tropical Japonica  504 85.10% 14.50% 0.00% 0.40% NA
Japonica Intermediate  241 60.20% 39.00% 0.00% 0.83% NA
VI/Aromatic  96 50.00% 49.00% 0.00% 1.04% NA
Intermediate  90 46.70% 27.80% 2.22% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906802658 A -> G LOC_Os09g12050.1 upstream_gene_variant ; 603.0bp to feature; MODIFIER silent_mutation Average:37.495; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg0906802658 A -> G LOC_Os09g12020-LOC_Os09g12050 intergenic_region ; MODIFIER silent_mutation Average:37.495; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N
vg0906802658 A -> DEL N N silent_mutation Average:37.495; most accessible tissue: Zhenshan97 young leaf, score: 72.34 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906802658 3.23E-06 2.02E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 8.13E-07 2.36E-07 mr1080 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 6.42E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 6.92E-06 6.90E-07 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 1.78E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 6.54E-06 mr1618 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 7.04E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 4.33E-06 6.22E-09 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 5.61E-07 2.63E-08 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 1.98E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 4.85E-08 mr1203_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 2.22E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 8.22E-09 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 1.05E-06 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 4.31E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906802658 NA 9.49E-06 mr1746_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251