\
| Variant ID: vg0906802658 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6802658 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 222. )
AATTCATTGTTTCTTGTCATGAGTGCATTGAAAAATTGGGATGGTGAGGGCTCGAACAATGTAGAAGTTGTGTCGGGGTATATATAAAGAATGGCAATGA[A/G]
TTGAACAAGATAGAATTCAATACCATATAACAATAATGATACTGGATTGGCACACCGGAAATTCACAACGGCCAGACTCGAAGTCTCTTTTAAGGCATGA
TCATGCCTTAAAAGAGACTTCGAGTCTGGCCGTTGTGAATTTCCGGTGTGCCAATCCAGTATCATTATTGTTATATGGTATTGAATTCTATCTTGTTCAA[T/C]
TCATTGCCATTCTTTATATATACCCCGACACAACTTCTACATTGTTCGAGCCCTCACCATCCCAATTTTTCAATGCACTCATGACAAGAAACAATGAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.00% | 29.70% | 0.66% | 35.72% | NA |
| All Indica | 2759 | 4.20% | 35.60% | 1.01% | 59.19% | NA |
| All Japonica | 1512 | 86.50% | 13.20% | 0.00% | 0.33% | NA |
| Aus | 269 | 33.80% | 55.40% | 0.37% | 10.41% | NA |
| Indica I | 595 | 2.00% | 34.60% | 0.67% | 62.69% | NA |
| Indica II | 465 | 8.40% | 22.80% | 1.51% | 67.31% | NA |
| Indica III | 913 | 2.70% | 42.70% | 0.77% | 53.78% | NA |
| Indica Intermediate | 786 | 5.10% | 35.60% | 1.27% | 58.02% | NA |
| Temperate Japonica | 767 | 95.70% | 4.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 85.10% | 14.50% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 60.20% | 39.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 50.00% | 49.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 46.70% | 27.80% | 2.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906802658 | A -> G | LOC_Os09g12050.1 | upstream_gene_variant ; 603.0bp to feature; MODIFIER | silent_mutation | Average:37.495; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| vg0906802658 | A -> G | LOC_Os09g12020-LOC_Os09g12050 | intergenic_region ; MODIFIER | silent_mutation | Average:37.495; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| vg0906802658 | A -> DEL | N | N | silent_mutation | Average:37.495; most accessible tissue: Zhenshan97 young leaf, score: 72.34 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906802658 | 3.23E-06 | 2.02E-07 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | 8.13E-07 | 2.36E-07 | mr1080 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 6.42E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | 6.92E-06 | 6.90E-07 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 1.78E-06 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 6.54E-06 | mr1618 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 7.04E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | 4.33E-06 | 6.22E-09 | mr1071_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | 5.61E-07 | 2.63E-08 | mr1080_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 1.98E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 4.85E-08 | mr1203_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 2.22E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 8.22E-09 | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 1.05E-06 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 4.31E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906802658 | NA | 9.49E-06 | mr1746_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |