\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906775937:

Variant ID: vg0906775937 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6775937
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, C: 0.28, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTCTGAAGATTACGAAAGGAATCATCAGCTGAGAAGGACCCAGAGAGAGAGCCTCCGCCGGGCCGCCGTCTCTCCTCCCGCCACCTACCCCTCCCCCC[G/C]
TCGGATTTGGTGGAGAAATTTGGAAGAGAGGAGAGAGGGGATGAGTAGGAAGACCTTGACGACGTGAAGAGAGGCCAGCGATAACGCCCAACGATGATGA

Reverse complement sequence

TCATCATCGTTGGGCGTTATCGCTGGCCTCTCTTCACGTCGTCAAGGTCTTCCTACTCATCCCCTCTCTCCTCTCTTCCAAATTTCTCCACCAAATCCGA[C/G]
GGGGGGAGGGGTAGGTGGCGGGAGGAGAGACGGCGGCCCGGCGGAGGCTCTCTCTCTGGGTCCTTCTCAGCTGATGATTCCTTTCGTAATCTTCAGAAAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 47.50% 0.11% 0.61% NA
All Indica  2759 34.40% 65.50% 0.11% 0.07% NA
All Japonica  1512 87.40% 12.60% 0.00% 0.00% NA
Aus  269 13.40% 76.20% 0.37% 10.04% NA
Indica I  595 28.60% 71.10% 0.17% 0.17% NA
Indica II  465 42.80% 57.20% 0.00% 0.00% NA
Indica III  913 29.80% 70.20% 0.00% 0.00% NA
Indica Intermediate  786 39.10% 60.60% 0.25% 0.13% NA
Temperate Japonica  767 96.10% 3.90% 0.00% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 17.70% 1.04% 0.00% NA
Intermediate  90 70.00% 30.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906775937 G -> DEL N N silent_mutation Average:75.948; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0906775937 G -> C LOC_Os09g12020.1 downstream_gene_variant ; 3571.0bp to feature; MODIFIER silent_mutation Average:75.948; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N
vg0906775937 G -> C LOC_Os09g12020-LOC_Os09g12050 intergenic_region ; MODIFIER silent_mutation Average:75.948; most accessible tissue: Minghui63 young leaf, score: 90.17 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0906775937 G C -0.01 0.0 0.0 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906775937 NA 4.57E-06 mr1317 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906775937 NA 2.60E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906775937 NA 5.78E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906775937 NA 6.73E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906775937 NA 3.86E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906775937 2.45E-06 2.45E-06 mr1323_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251