Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906765331:

Variant ID: vg0906765331 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6765331
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, C: 0.20, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

AAATAAAAATTACCCTCAAATTCGACGGATCGCGGTCTGACCGAAGATGTTGCGTCGGTCTGACCGCCTGATGAACGTCGGTCTGACCGGGATCGAACTC[T/C]
GGTCGAACCGCCAAAATCACCTGCCTGCGCCTGTCGCCACCGCCGGTCTGTCCGCCGGTGCACCGCCGGTCTAACCGCCGAAACCCGGTGAAACACAAAT

Reverse complement sequence

ATTTGTGTTTCACCGGGTTTCGGCGGTTAGACCGGCGGTGCACCGGCGGACAGACCGGCGGTGGCGACAGGCGCAGGCAGGTGATTTTGGCGGTTCGACC[A/G]
GAGTTCGATCCCGGTCAGACCGACGTTCATCAGGCGGTCAGACCGACGCAACATCTTCGGTCAGACCGCGATCCGTCGAATTTGAGGGTAATTTTTATTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.30%	17.70%	0.30%	13.71%	NA
All Indica	2759	62.20%	14.30%	0.47%	23.05%	NA
All Japonica	1512	87.60%	12.40%	0.00%	0.00%	NA
Aus	269	14.50%	84.00%	0.00%	1.49%	NA
Indica I	595	36.30%	26.60%	0.50%	36.64%	NA
Indica II	465	64.90%	9.90%	0.65%	24.52%	NA
Indica III	913	74.30%	6.60%	0.44%	18.73%	NA
Indica Intermediate	786	66.20%	16.50%	0.38%	16.92%	NA
Temperate Japonica	767	96.30%	3.70%	0.00%	0.00%	NA
Tropical Japonica	504	86.70%	13.30%	0.00%	0.00%	NA
Japonica Intermediate	241	61.40%	38.60%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	15.60%	0.00%	1.04%	NA
Intermediate	90	77.80%	13.30%	1.11%	7.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906765331	T -> DEL	N	N	silent_mutation	Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg0906765331	T -> C	LOC_Os09g12000.1	upstream_gene_variant ; 4983.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg0906765331	T -> C	LOC_Os09g12010.1	upstream_gene_variant ; 1894.0bp to feature; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N
vg0906765331	T -> C	LOC_Os09g12010-LOC_Os09g12020	intergenic_region ; MODIFIER	silent_mutation	Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906765331	NA	7.50E-06	mr1008	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331	NA	5.27E-06	mr1009	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331	3.28E-06	3.09E-06	mr1973	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331	NA	2.60E-06	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331	NA	5.78E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331	NA	6.73E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331	NA	3.86E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331	2.45E-06	2.45E-06	mr1323_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251