\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906765331:

Variant ID: vg0906765331 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6765331
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, C: 0.20, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


AAATAAAAATTACCCTCAAATTCGACGGATCGCGGTCTGACCGAAGATGTTGCGTCGGTCTGACCGCCTGATGAACGTCGGTCTGACCGGGATCGAACTC[T/C]
GGTCGAACCGCCAAAATCACCTGCCTGCGCCTGTCGCCACCGCCGGTCTGTCCGCCGGTGCACCGCCGGTCTAACCGCCGAAACCCGGTGAAACACAAAT

Reverse complement sequence

ATTTGTGTTTCACCGGGTTTCGGCGGTTAGACCGGCGGTGCACCGGCGGACAGACCGGCGGTGGCGACAGGCGCAGGCAGGTGATTTTGGCGGTTCGACC[A/G]
GAGTTCGATCCCGGTCAGACCGACGTTCATCAGGCGGTCAGACCGACGCAACATCTTCGGTCAGACCGCGATCCGTCGAATTTGAGGGTAATTTTTATTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 17.70% 0.30% 13.71% NA
All Indica  2759 62.20% 14.30% 0.47% 23.05% NA
All Japonica  1512 87.60% 12.40% 0.00% 0.00% NA
Aus  269 14.50% 84.00% 0.00% 1.49% NA
Indica I  595 36.30% 26.60% 0.50% 36.64% NA
Indica II  465 64.90% 9.90% 0.65% 24.52% NA
Indica III  913 74.30% 6.60% 0.44% 18.73% NA
Indica Intermediate  786 66.20% 16.50% 0.38% 16.92% NA
Temperate Japonica  767 96.30% 3.70% 0.00% 0.00% NA
Tropical Japonica  504 86.70% 13.30% 0.00% 0.00% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 83.30% 15.60% 0.00% 1.04% NA
Intermediate  90 77.80% 13.30% 1.11% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906765331 T -> DEL N N silent_mutation Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0906765331 T -> C LOC_Os09g12000.1 upstream_gene_variant ; 4983.0bp to feature; MODIFIER silent_mutation Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0906765331 T -> C LOC_Os09g12010.1 upstream_gene_variant ; 1894.0bp to feature; MODIFIER silent_mutation Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N
vg0906765331 T -> C LOC_Os09g12010-LOC_Os09g12020 intergenic_region ; MODIFIER silent_mutation Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906765331 NA 7.50E-06 mr1008 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331 NA 5.27E-06 mr1009 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331 3.28E-06 3.09E-06 mr1973 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331 NA 2.60E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331 NA 5.78E-06 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331 NA 6.73E-06 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331 NA 3.86E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906765331 2.45E-06 2.45E-06 mr1323_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251