\
| Variant ID: vg0906765331 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6765331 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, C: 0.20, others allele: 0.00, population size: 101. )
AAATAAAAATTACCCTCAAATTCGACGGATCGCGGTCTGACCGAAGATGTTGCGTCGGTCTGACCGCCTGATGAACGTCGGTCTGACCGGGATCGAACTC[T/C]
GGTCGAACCGCCAAAATCACCTGCCTGCGCCTGTCGCCACCGCCGGTCTGTCCGCCGGTGCACCGCCGGTCTAACCGCCGAAACCCGGTGAAACACAAAT
ATTTGTGTTTCACCGGGTTTCGGCGGTTAGACCGGCGGTGCACCGGCGGACAGACCGGCGGTGGCGACAGGCGCAGGCAGGTGATTTTGGCGGTTCGACC[A/G]
GAGTTCGATCCCGGTCAGACCGACGTTCATCAGGCGGTCAGACCGACGCAACATCTTCGGTCAGACCGCGATCCGTCGAATTTGAGGGTAATTTTTATTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.30% | 17.70% | 0.30% | 13.71% | NA |
| All Indica | 2759 | 62.20% | 14.30% | 0.47% | 23.05% | NA |
| All Japonica | 1512 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 14.50% | 84.00% | 0.00% | 1.49% | NA |
| Indica I | 595 | 36.30% | 26.60% | 0.50% | 36.64% | NA |
| Indica II | 465 | 64.90% | 9.90% | 0.65% | 24.52% | NA |
| Indica III | 913 | 74.30% | 6.60% | 0.44% | 18.73% | NA |
| Indica Intermediate | 786 | 66.20% | 16.50% | 0.38% | 16.92% | NA |
| Temperate Japonica | 767 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 61.40% | 38.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 15.60% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 77.80% | 13.30% | 1.11% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906765331 | T -> DEL | N | N | silent_mutation | Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099 | N | N | N | N |
| vg0906765331 | T -> C | LOC_Os09g12000.1 | upstream_gene_variant ; 4983.0bp to feature; MODIFIER | silent_mutation | Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099 | N | N | N | N |
| vg0906765331 | T -> C | LOC_Os09g12010.1 | upstream_gene_variant ; 1894.0bp to feature; MODIFIER | silent_mutation | Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099 | N | N | N | N |
| vg0906765331 | T -> C | LOC_Os09g12010-LOC_Os09g12020 | intergenic_region ; MODIFIER | silent_mutation | Average:49.713; most accessible tissue: Minghui63 flag leaf, score: 67.099 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906765331 | NA | 7.50E-06 | mr1008 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906765331 | NA | 5.27E-06 | mr1009 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906765331 | 3.28E-06 | 3.09E-06 | mr1973 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906765331 | NA | 2.60E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906765331 | NA | 5.78E-06 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906765331 | NA | 6.73E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906765331 | NA | 3.86E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906765331 | 2.45E-06 | 2.45E-06 | mr1323_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |