\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906750195:

Variant ID: vg0906750195 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6750195
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, G: 0.34, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


AATATTTACTGTAGCACCATATTGTCTAATCATATAGCAATTAGGTTTTAAAAATTCGTCTCGCGATTTACATGTAATCTGTGTAATTAGTTATTTTTTA[G/T]
TTATATTTAATACTTTATATATGTGTCCAAACATCCGATATGACGGGGTAAAAAATTTTATCAGGGGATCTAAATAGGCCCTTAGGGTCTAGAGATGTAC

Reverse complement sequence

GTACATCTCTAGACCCTAAGGGCCTATTTAGATCCCCTGATAAAATTTTTTACCCCGTCATATCGGATGTTTGGACACATATATAAAGTATTAAATATAA[C/A]
TAAAAAATAACTAATTACACAGATTACATGTAAATCGCGAGACGAATTTTTAAAACCTAATTGCTATATGATTAGACAATATGGTGCTACAGTAAATATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 24.20% 0.44% 0.85% NA
All Indica  2759 97.60% 2.20% 0.14% 0.00% NA
All Japonica  1512 30.30% 68.80% 0.79% 0.07% NA
Aus  269 99.30% 0.40% 0.00% 0.37% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 92.70% 7.10% 0.22% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 97.10% 2.50% 0.38% 0.00% NA
Temperate Japonica  767 27.80% 71.10% 1.17% 0.00% NA
Tropical Japonica  504 22.40% 77.40% 0.20% 0.00% NA
Japonica Intermediate  241 54.80% 44.00% 0.83% 0.41% NA
VI/Aromatic  96 54.20% 8.30% 3.12% 34.38% NA
Intermediate  90 56.70% 35.60% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906750195 G -> DEL N N silent_mutation Average:43.081; most accessible tissue: Callus, score: 74.998 N N N N
vg0906750195 G -> T LOC_Os09g11970.1 downstream_gene_variant ; 3819.0bp to feature; MODIFIER silent_mutation Average:43.081; most accessible tissue: Callus, score: 74.998 N N N N
vg0906750195 G -> T LOC_Os09g11980.1 downstream_gene_variant ; 1265.0bp to feature; MODIFIER silent_mutation Average:43.081; most accessible tissue: Callus, score: 74.998 N N N N
vg0906750195 G -> T LOC_Os09g11970-LOC_Os09g11980 intergenic_region ; MODIFIER silent_mutation Average:43.081; most accessible tissue: Callus, score: 74.998 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906750195 NA 5.52E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 7.83E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 5.54E-06 mr1053_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 2.75E-06 1.38E-37 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 5.87E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 7.94E-09 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 3.20E-06 6.42E-33 mr1617_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 6.56E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 1.87E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 3.78E-11 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 6.90E-07 mr1727_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 3.50E-07 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906750195 NA 5.05E-06 mr1856_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251