Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0906700489:

Variant ID: vg0906700489 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6700489
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


TGACAGGCTGTCGTAAGGAACTCGGCAGTCAGGGGTGGCTTCTCGAAGTACCAGGAGGGCATCGGATAGAGGGTATTAGCTAGTATATCAGTTAACTAGA[A/T]
TGTATGTATAATATGTATATTAGAAGTATAGGAATGGATTCTTTTTCTTTTTTCTTTCCACCTAGCTTAGATTATTTATTATGAGGATGAGTAGTTAAAT

Reverse complement sequence

ATTTAACTACTCATCCTCATAATAAATAATCTAAGCTAGGTGGAAAGAAAAAAGAAAAAGAATCCATTCCTATACTTCTAATATACATATTATACATACA[T/A]
TCTAGTTAACTGATATACTAGCTAATACCCTCTATCCGATGCCCTCCTGGTACTTCGAGAAGCCACCCCTGACTGCCGAGTTCCTTACGACAGCCTGTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 1.50% 1.10% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 92.00% 4.60% 3.37% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 88.90% 5.70% 5.35% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 8.70% 4.15% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906700489 A -> T LOC_Os09g11910.1 upstream_gene_variant ; 1728.0bp to feature; MODIFIER silent_mutation Average:33.07; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0906700489 A -> T LOC_Os09g11920.1 upstream_gene_variant ; 2583.0bp to feature; MODIFIER silent_mutation Average:33.07; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N
vg0906700489 A -> T LOC_Os09g11910-LOC_Os09g11920 intergenic_region ; MODIFIER silent_mutation Average:33.07; most accessible tissue: Minghui63 young leaf, score: 66.656 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906700489 NA 6.66E-06 mr1245 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 5.84E-06 mr1697 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 9.35E-06 mr1788 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 1.30E-06 mr1851 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 1.43E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 3.06E-06 5.84E-08 mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 6.02E-07 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 7.25E-07 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 1.06E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 2.00E-07 mr1531_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 5.04E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 7.15E-06 7.15E-06 mr1637_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 1.52E-08 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 1.12E-06 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 3.18E-08 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 9.57E-06 mr1813_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906700489 NA 4.93E-07 mr1986_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251