Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906681211:

Variant ID: vg0906681211 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6681211
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

CAAATAATTATTGTAACAATTTTTAAATTTTTGTACCTCTTTTCGCAGGCAGCGAATTCTAATTTTTGCAGGCGGACGTTGCATATTTTCCTAGGCAGCC[C/T]
GTTTAGCTCCACTTCGCCTGGGAAAAAAATCTTCCCAGGCAGGCGTCCCGCCGCCGATCTTCGCAGTCGTTTGGGTGCAAGTGGAGCGTCCGGGAAGACT

Reverse complement sequence

AGTCTTCCCGGACGCTCCACTTGCACCCAAACGACTGCGAAGATCGGCGGCGGGACGCCTGCCTGGGAAGATTTTTTTCCCAGGCGAAGTGGAGCTAAAC[G/A]
GGCTGCCTAGGAAAATATGCAACGTCCGCCTGCAAAAATTAGAATTCGCTGCCTGCGAAAAGAGGTACAAAAATTTAAAAATTGTTACAATAATTATTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	80.20%	13.20%	5.23%	1.40%	NA
All Indica	2759	77.20%	12.10%	8.48%	2.28%	NA
All Japonica	1512	83.50%	16.00%	0.33%	0.20%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	87.90%	2.40%	8.07%	1.68%	NA
Indica II	465	63.70%	28.80%	6.67%	0.86%	NA
Indica III	913	83.00%	5.90%	8.00%	3.07%	NA
Indica Intermediate	786	70.20%	16.70%	10.43%	2.67%	NA
Temperate Japonica	767	84.10%	15.90%	0.00%	0.00%	NA
Tropical Japonica	504	88.90%	10.90%	0.20%	0.00%	NA
Japonica Intermediate	241	70.10%	27.00%	1.66%	1.24%	NA
VI/Aromatic	96	67.70%	30.20%	2.08%	0.00%	NA
Intermediate	90	73.30%	20.00%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906681211	C -> DEL	N	N	silent_mutation	Average:39.651; most accessible tissue: Callus, score: 62.689	N	N	N	N
vg0906681211	C -> T	LOC_Os09g11890.1	downstream_gene_variant ; 2236.0bp to feature; MODIFIER	silent_mutation	Average:39.651; most accessible tissue: Callus, score: 62.689	N	N	N	N
vg0906681211	C -> T	LOC_Os09g11890-LOC_Os09g11900	intergenic_region ; MODIFIER	silent_mutation	Average:39.651; most accessible tissue: Callus, score: 62.689	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906681211	NA	9.37E-06	mr1245	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	5.77E-06	mr1280	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	6.65E-06	mr1280	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	3.67E-06	mr1318	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	7.21E-07	mr1788	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	4.47E-06	mr1974	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	3.62E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	7.21E-06	7.21E-06	mr1141_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	3.84E-07	mr1298_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	1.30E-07	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	7.10E-07	mr1510_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	7.51E-06	mr1531_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	2.77E-06	2.77E-06	mr1574_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	8.02E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	9.69E-06	3.00E-08	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	6.80E-07	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	1.00E-06	mr1731_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	1.77E-09	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906681211	NA	1.29E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251