\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906664708:

Variant ID: vg0906664708 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6664708
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GAAAGTGATAGTAGCATTATTTACAAAATTGACAAATCTCTTATCTGGTTTATAAATTATAACACATATATGTAAAAGTTGTGAATACTATTACTAACAT[T/A]
TTGTCAAATGAAGAAATAACAAAAATAAAAGTTTTAGATCTTGATGAGTTATTCAACTTTGTTGTTGATGACTTTTTCAATTGAAATCATTTAGTACTTG

Reverse complement sequence

CAAGTACTAAATGATTTCAATTGAAAAAGTCATCAACAACAAAGTTGAATAACTCATCAAGATCTAAAACTTTTATTTTTGTTATTTCTTCATTTGACAA[A/T]
ATGTTAGTAATAGTATTCACAACTTTTACATATATGTGTTATAATTTATAAACCAGATAAGAGATTTGTCAATTTTGTAAATAATGCTACTATCACTTTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 13.30% 0.06% 0.00% NA
All Indica  2759 87.90% 12.10% 0.07% 0.00% NA
All Japonica  1512 84.00% 16.00% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 97.60% 2.20% 0.17% 0.00% NA
Indica II  465 71.20% 28.60% 0.22% 0.00% NA
Indica III  913 94.10% 5.90% 0.00% 0.00% NA
Indica Intermediate  786 83.10% 16.90% 0.00% 0.00% NA
Temperate Japonica  767 84.10% 15.90% 0.00% 0.00% NA
Tropical Japonica  504 89.30% 10.70% 0.00% 0.00% NA
Japonica Intermediate  241 72.60% 27.40% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906664708 T -> A LOC_Os09g11880.1 upstream_gene_variant ; 1035.0bp to feature; MODIFIER silent_mutation Average:13.547; most accessible tissue: Zhenshan97 flag leaf, score: 17.069 N N N N
vg0906664708 T -> A LOC_Os09g11870-LOC_Os09g11880 intergenic_region ; MODIFIER silent_mutation Average:13.547; most accessible tissue: Zhenshan97 flag leaf, score: 17.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906664708 NA 1.87E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 1.16E-06 1.16E-06 mr1141_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 7.72E-06 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 4.19E-07 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 3.97E-08 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 4.60E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 1.90E-07 1.90E-07 mr1637_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 3.41E-07 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 1.27E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 1.01E-06 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 7.92E-06 mr1735_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 8.32E-06 1.17E-09 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708 NA 5.09E-06 mr1996_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251