Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906664708:

Variant ID: vg0906664708 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6664708
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAGTGATAGTAGCATTATTTACAAAATTGACAAATCTCTTATCTGGTTTATAAATTATAACACATATATGTAAAAGTTGTGAATACTATTACTAACAT[T/A]
TTGTCAAATGAAGAAATAACAAAAATAAAAGTTTTAGATCTTGATGAGTTATTCAACTTTGTTGTTGATGACTTTTTCAATTGAAATCATTTAGTACTTG

Reverse complement sequence

CAAGTACTAAATGATTTCAATTGAAAAAGTCATCAACAACAAAGTTGAATAACTCATCAAGATCTAAAACTTTTATTTTTGTTATTTCTTCATTTGACAA[A/T]
ATGTTAGTAATAGTATTCACAACTTTTACATATATGTGTTATAATTTATAAACCAGATAAGAGATTTGTCAATTTTGTAAATAATGCTACTATCACTTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	13.30%	0.06%	0.00%	NA
All Indica	2759	87.90%	12.10%	0.07%	0.00%	NA
All Japonica	1512	84.00%	16.00%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	97.60%	2.20%	0.17%	0.00%	NA
Indica II	465	71.20%	28.60%	0.22%	0.00%	NA
Indica III	913	94.10%	5.90%	0.00%	0.00%	NA
Indica Intermediate	786	83.10%	16.90%	0.00%	0.00%	NA
Temperate Japonica	767	84.10%	15.90%	0.00%	0.00%	NA
Tropical Japonica	504	89.30%	10.70%	0.00%	0.00%	NA
Japonica Intermediate	241	72.60%	27.40%	0.00%	0.00%	NA
VI/Aromatic	96	67.70%	32.30%	0.00%	0.00%	NA
Intermediate	90	78.90%	20.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906664708	T -> A	LOC_Os09g11880.1	upstream_gene_variant ; 1035.0bp to feature; MODIFIER	silent_mutation	Average:13.547; most accessible tissue: Zhenshan97 flag leaf, score: 17.069	N	N	N	N
vg0906664708	T -> A	LOC_Os09g11870-LOC_Os09g11880	intergenic_region ; MODIFIER	silent_mutation	Average:13.547; most accessible tissue: Zhenshan97 flag leaf, score: 17.069	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906664708	NA	1.87E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	1.16E-06	1.16E-06	mr1141_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	7.72E-06	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	4.19E-07	mr1298_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	3.97E-08	mr1318_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	4.60E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	1.90E-07	1.90E-07	mr1637_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	3.41E-07	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	1.27E-06	mr1729_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	1.01E-06	mr1731_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	7.92E-06	mr1735_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	8.32E-06	1.17E-09	mr1788_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906664708	NA	5.09E-06	mr1996_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251