Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906640167:

Variant ID: vg0906640167 (JBrowse)	Variation Type: SNP
Chromosome: chr09	Position: 6640167
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GTACACCATAGTTAAAACTCTCTCACAATGTAAGTCATTCTAACATTTCCTATATTCATATTGATTTTAGTGAATCTAGATAGATATATATGTCTAGATT[C/T,A]
ATTAACATCAATATGAATGTGGAAAATGCTAGAATGACTTGCATTGTGAAACGGAGGGAGTATTAACTTTTGTCTGTCATAACACATGTGTAATTGATTA

Reverse complement sequence

TAATCAATTACACATGTGTTATGACAGACAAAAGTTAATACTCCCTCCGTTTCACAATGCAAGTCATTCTAGCATTTTCCACATTCATATTGATGTTAAT[G/A,T]
AATCTAGACATATATATCTATCTAGATTCACTAAAATCAATATGAATATAGGAAATGTTAGAATGACTTACATTGTGAGAGAGTTTTAACTATGGTGTAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.40%	24.80%	1.02%	0.72%	A: 0.02%
All Indica	2759	60.10%	38.00%	0.58%	1.23%	A: 0.04%
All Japonica	1512	97.60%	2.40%	0.00%	0.00%	NA
Aus	269	69.90%	19.00%	11.15%	0.00%	NA
Indica I	595	65.90%	31.40%	1.01%	1.68%	NA
Indica II	465	70.80%	28.40%	0.00%	0.86%	NA
Indica III	913	46.50%	51.70%	0.33%	1.31%	A: 0.11%
Indica Intermediate	786	65.30%	32.80%	0.89%	1.02%	NA
Temperate Japonica	767	98.00%	2.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.80%	1.20%	0.00%	0.00%	NA
Japonica Intermediate	241	93.80%	6.20%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	21.90%	2.08%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0906640167	C -> DEL	N	N	silent_mutation	Average:52.634; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg0906640167	C -> T	LOC_Os09g11850.1	downstream_gene_variant ; 2856.0bp to feature; MODIFIER	silent_mutation	Average:52.634; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg0906640167	C -> T	LOC_Os09g11840.1	intron_variant ; MODIFIER	silent_mutation	Average:52.634; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg0906640167	C -> A	LOC_Os09g11850.1	downstream_gene_variant ; 2856.0bp to feature; MODIFIER	silent_mutation	Average:52.634; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N
vg0906640167	C -> A	LOC_Os09g11840.1	intron_variant ; MODIFIER	silent_mutation	Average:52.634; most accessible tissue: Zhenshan97 young leaf, score: 74.675	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0906640167	NA	6.16E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906640167	1.20E-07	1.20E-07	mr1389	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906640167	2.05E-07	4.76E-09	mr1038_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906640167	NA	6.11E-07	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906640167	1.12E-06	1.12E-06	mr1389_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251