\
| Variant ID: vg0906547680 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6547680 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.03, others allele: 0.00, population size: 117. )
CCTCCGTTCCAAAATAAATCAACTTATAGAATTCAAACTTTGTCCTAAAATAAATCAACTTCTATCTTCTTATTCACTGTTGATTCGCAAATCAAAAAAA[T/A]
TTATTCCTTCAATACCCCTTGCCTACATATCTACCAATACTAGCTATTAATATATGCAGGTAGTTTTCAGGGCAACACATTGACTCCGGTCTTGGGCACA
TGTGCCCAAGACCGGAGTCAATGTGTTGCCCTGAAAACTACCTGCATATATTAATAGCTAGTATTGGTAGATATGTAGGCAAGGGGTATTGAAGGAATAA[A/T]
TTTTTTTGATTTGCGAATCAACAGTGAATAAGAAGATAGAAGTTGATTTATTTTAGGACAAAGTTTGAATTCTATAAGTTGATTTATTTTGGAACGGAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 31.80% | 0.28% | 1.69% | NA |
| All Indica | 2759 | 48.50% | 50.10% | 0.40% | 1.05% | NA |
| All Japonica | 1512 | 98.50% | 0.50% | 0.07% | 0.93% | NA |
| Aus | 269 | 51.30% | 35.30% | 0.00% | 13.38% | NA |
| Indica I | 595 | 29.60% | 70.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 63.40% | 30.50% | 1.29% | 4.73% | NA |
| Indica III | 913 | 48.50% | 51.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 53.90% | 44.70% | 0.51% | 0.89% | NA |
| Temperate Japonica | 767 | 99.20% | 0.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 96.80% | 0.40% | 0.20% | 2.58% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 16.70% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906547680 | T -> DEL | N | N | silent_mutation | Average:47.699; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| vg0906547680 | T -> A | LOC_Os09g11730.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.699; most accessible tissue: Zhenshan97 young leaf, score: 74.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906547680 | NA | 4.22E-06 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906547680 | NA | 2.43E-06 | mr1137_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906547680 | 6.13E-08 | 8.66E-07 | mr1160_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906547680 | NA | 2.12E-06 | mr1160_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906547680 | NA | 6.57E-07 | mr1201_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906547680 | NA | 1.79E-06 | mr1219_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906547680 | NA | 5.56E-06 | mr1617_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |