\
| Variant ID: vg0906540051 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6540051 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 93. )
ACAAGCGCTCGAATGCTGTCACCCGCTTTCTCTTGTTGTTGCGCTTCTGAGATGGGGTTGAGGTTGGCTTCTTCTTAGGCTCACCGTCGCCAAGCTGGAA[T/C]
TGCTCCTTCACCTTGGGCGCCTTGGGCGTGGCCTTTTGGGGTGAAGGACGATTATTGCAGGGTGCGAGCTATGGCTACGATTGCGAGGGTTTGGCTTGGG
CCCAAGCCAAACCCTCGCAATCGTAGCCATAGCTCGCACCCTGCAATAATCGTCCTTCACCCCAAAAGGCCACGCCCAAGGCGCCCAAGGTGAAGGAGCA[A/G]
TTCCAGCTTGGCGACGGTGAGCCTAAGAAGAAGCCAACCTCAACCCCATCTCAGAAGCGCAACAACAAGAGAAAGCGGGTGACAGCATTCGAGCGCTTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.00% | 31.70% | 1.69% | 27.59% | NA |
| All Indica | 2759 | 16.90% | 35.40% | 2.79% | 44.91% | NA |
| All Japonica | 1512 | 86.00% | 13.00% | 0.00% | 0.99% | NA |
| Aus | 269 | 7.80% | 78.80% | 0.00% | 13.38% | NA |
| Indica I | 595 | 27.70% | 6.10% | 3.70% | 62.52% | NA |
| Indica II | 465 | 7.70% | 56.80% | 1.29% | 34.19% | NA |
| Indica III | 913 | 13.30% | 38.20% | 2.63% | 45.89% | NA |
| Indica Intermediate | 786 | 18.20% | 41.90% | 3.18% | 36.77% | NA |
| Temperate Japonica | 767 | 96.30% | 3.40% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 84.10% | 13.30% | 0.00% | 2.58% | NA |
| Japonica Intermediate | 241 | 57.30% | 42.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 35.60% | 3.33% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906540051 | T -> DEL | LOC_Os09g11720.1 | N | frameshift_variant | Average:43.096; most accessible tissue: Minghui63 young leaf, score: 86.378 | N | N | N | N |
| vg0906540051 | T -> C | LOC_Os09g11720.1 | missense_variant ; p.Ile76Thr; MODERATE | nonsynonymous_codon ; I76A | Average:43.096; most accessible tissue: Minghui63 young leaf, score: 86.378 | unknown | unknown | TOLERATED | 0.11 |
| vg0906540051 | T -> C | LOC_Os09g11720.1 | missense_variant ; p.Ile76Thr; MODERATE | nonsynonymous_codon ; I76T | Average:43.096; most accessible tissue: Minghui63 young leaf, score: 86.378 | unknown | unknown | TOLERATED | 0.34 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906540051 | NA | 5.38E-20 | mr1557 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906540051 | NA | 3.67E-09 | mr1557 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906540051 | 4.08E-06 | 8.20E-07 | mr1098_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906540051 | NA | 5.97E-06 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906540051 | NA | 8.05E-06 | mr1150_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906540051 | NA | 2.97E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906540051 | NA | 1.77E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |