\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906540051:

Variant ID: vg0906540051 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6540051
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.79, T: 0.21, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAGCGCTCGAATGCTGTCACCCGCTTTCTCTTGTTGTTGCGCTTCTGAGATGGGGTTGAGGTTGGCTTCTTCTTAGGCTCACCGTCGCCAAGCTGGAA[T/C]
TGCTCCTTCACCTTGGGCGCCTTGGGCGTGGCCTTTTGGGGTGAAGGACGATTATTGCAGGGTGCGAGCTATGGCTACGATTGCGAGGGTTTGGCTTGGG

Reverse complement sequence

CCCAAGCCAAACCCTCGCAATCGTAGCCATAGCTCGCACCCTGCAATAATCGTCCTTCACCCCAAAAGGCCACGCCCAAGGCGCCCAAGGTGAAGGAGCA[A/G]
TTCCAGCTTGGCGACGGTGAGCCTAAGAAGAAGCCAACCTCAACCCCATCTCAGAAGCGCAACAACAAGAGAAAGCGGGTGACAGCATTCGAGCGCTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.00% 31.70% 1.69% 27.59% NA
All Indica  2759 16.90% 35.40% 2.79% 44.91% NA
All Japonica  1512 86.00% 13.00% 0.00% 0.99% NA
Aus  269 7.80% 78.80% 0.00% 13.38% NA
Indica I  595 27.70% 6.10% 3.70% 62.52% NA
Indica II  465 7.70% 56.80% 1.29% 34.19% NA
Indica III  913 13.30% 38.20% 2.63% 45.89% NA
Indica Intermediate  786 18.20% 41.90% 3.18% 36.77% NA
Temperate Japonica  767 96.30% 3.40% 0.00% 0.26% NA
Tropical Japonica  504 84.10% 13.30% 0.00% 2.58% NA
Japonica Intermediate  241 57.30% 42.70% 0.00% 0.00% NA
VI/Aromatic  96 14.60% 85.40% 0.00% 0.00% NA
Intermediate  90 45.60% 35.60% 3.33% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906540051 T -> DEL LOC_Os09g11720.1 N frameshift_variant Average:43.096; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg0906540051 T -> C LOC_Os09g11720.1 missense_variant ; p.Ile76Thr; MODERATE nonsynonymous_codon ; I76A Average:43.096; most accessible tissue: Minghui63 young leaf, score: 86.378 unknown unknown TOLERATED 0.11
vg0906540051 T -> C LOC_Os09g11720.1 missense_variant ; p.Ile76Thr; MODERATE nonsynonymous_codon ; I76T Average:43.096; most accessible tissue: Minghui63 young leaf, score: 86.378 unknown unknown TOLERATED 0.34

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906540051 NA 5.38E-20 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906540051 NA 3.67E-09 mr1557 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906540051 4.08E-06 8.20E-07 mr1098_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906540051 NA 5.97E-06 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906540051 NA 8.05E-06 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906540051 NA 2.97E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906540051 NA 1.77E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251