\
| Variant ID: vg0906527724 (JBrowse) | Variation Type: SNP |
| Chromosome: chr09 | Position: 6527724 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTATGCCACTAGATCTTCACTATTTATCATACTATTGAATATATGAATGTTTGCAGTCACATGATTTTGAACCAAAGGTTATTTTGGTCATTTATGCAA[G/A]
AAAAAAAAAGACATGTGACTTGACCCTAGTCAGTCAACACGCAGTCAACAGTCGAGAGTGAGAGGGTGCACAAATTTAAGCCAATCGCATATAGAGGAAG
CTTCCTCTATATGCGATTGGCTTAAATTTGTGCACCCTCTCACTCTCGACTGTTGACTGCGTGTTGACTGACTAGGGTCAAGTCACATGTCTTTTTTTTT[C/T]
TTGCATAAATGACCAAAATAACCTTTGGTTCAAAATCATGTGACTGCAAACATTCATATATTCAATAGTATGATAAATAGTGAAGATCTAGTGGCATAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 40.20% | 14.40% | 12.38% | 33.01% | NA |
| All Indica | 2759 | 18.20% | 15.00% | 20.15% | 46.57% | NA |
| All Japonica | 1512 | 86.60% | 1.60% | 0.86% | 10.91% | NA |
| Aus | 269 | 9.70% | 53.20% | 2.60% | 34.57% | NA |
| Indica I | 595 | 28.10% | 1.00% | 5.21% | 65.71% | NA |
| Indica II | 465 | 11.40% | 37.40% | 19.35% | 31.83% | NA |
| Indica III | 913 | 13.00% | 9.60% | 32.64% | 44.69% | NA |
| Indica Intermediate | 786 | 20.90% | 18.70% | 17.43% | 43.00% | NA |
| Temperate Japonica | 767 | 96.60% | 0.30% | 0.39% | 2.74% | NA |
| Tropical Japonica | 504 | 85.10% | 0.60% | 0.99% | 13.29% | NA |
| Japonica Intermediate | 241 | 58.10% | 7.90% | 2.07% | 31.95% | NA |
| VI/Aromatic | 96 | 15.60% | 80.20% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 50.00% | 25.60% | 8.89% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0906527724 | G -> DEL | N | N | silent_mutation | Average:31.455; most accessible tissue: Callus, score: 77.59 | N | N | N | N |
| vg0906527724 | G -> A | LOC_Os09g11690.1 | upstream_gene_variant ; 2154.0bp to feature; MODIFIER | silent_mutation | Average:31.455; most accessible tissue: Callus, score: 77.59 | N | N | N | N |
| vg0906527724 | G -> A | LOC_Os09g11700.1 | upstream_gene_variant ; 700.0bp to feature; MODIFIER | silent_mutation | Average:31.455; most accessible tissue: Callus, score: 77.59 | N | N | N | N |
| vg0906527724 | G -> A | LOC_Os09g11700-LOC_Os09g11710 | intergenic_region ; MODIFIER | silent_mutation | Average:31.455; most accessible tissue: Callus, score: 77.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0906527724 | NA | 7.73E-06 | mr1169_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906527724 | NA | 3.07E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906527724 | NA | 9.64E-09 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906527724 | NA | 8.48E-07 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906527724 | 5.42E-06 | NA | mr1904_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0906527724 | 4.11E-06 | 4.10E-06 | mr1947_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |