\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0906527724:

Variant ID: vg0906527724 (JBrowse)Variation Type: SNP
Chromosome: chr09Position: 6527724
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATGCCACTAGATCTTCACTATTTATCATACTATTGAATATATGAATGTTTGCAGTCACATGATTTTGAACCAAAGGTTATTTTGGTCATTTATGCAA[G/A]
AAAAAAAAAGACATGTGACTTGACCCTAGTCAGTCAACACGCAGTCAACAGTCGAGAGTGAGAGGGTGCACAAATTTAAGCCAATCGCATATAGAGGAAG

Reverse complement sequence

CTTCCTCTATATGCGATTGGCTTAAATTTGTGCACCCTCTCACTCTCGACTGTTGACTGCGTGTTGACTGACTAGGGTCAAGTCACATGTCTTTTTTTTT[C/T]
TTGCATAAATGACCAAAATAACCTTTGGTTCAAAATCATGTGACTGCAAACATTCATATATTCAATAGTATGATAAATAGTGAAGATCTAGTGGCATAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.20% 14.40% 12.38% 33.01% NA
All Indica  2759 18.20% 15.00% 20.15% 46.57% NA
All Japonica  1512 86.60% 1.60% 0.86% 10.91% NA
Aus  269 9.70% 53.20% 2.60% 34.57% NA
Indica I  595 28.10% 1.00% 5.21% 65.71% NA
Indica II  465 11.40% 37.40% 19.35% 31.83% NA
Indica III  913 13.00% 9.60% 32.64% 44.69% NA
Indica Intermediate  786 20.90% 18.70% 17.43% 43.00% NA
Temperate Japonica  767 96.60% 0.30% 0.39% 2.74% NA
Tropical Japonica  504 85.10% 0.60% 0.99% 13.29% NA
Japonica Intermediate  241 58.10% 7.90% 2.07% 31.95% NA
VI/Aromatic  96 15.60% 80.20% 1.04% 3.12% NA
Intermediate  90 50.00% 25.60% 8.89% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0906527724 G -> DEL N N silent_mutation Average:31.455; most accessible tissue: Callus, score: 77.59 N N N N
vg0906527724 G -> A LOC_Os09g11690.1 upstream_gene_variant ; 2154.0bp to feature; MODIFIER silent_mutation Average:31.455; most accessible tissue: Callus, score: 77.59 N N N N
vg0906527724 G -> A LOC_Os09g11700.1 upstream_gene_variant ; 700.0bp to feature; MODIFIER silent_mutation Average:31.455; most accessible tissue: Callus, score: 77.59 N N N N
vg0906527724 G -> A LOC_Os09g11700-LOC_Os09g11710 intergenic_region ; MODIFIER silent_mutation Average:31.455; most accessible tissue: Callus, score: 77.59 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0906527724 NA 7.73E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906527724 NA 3.07E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906527724 NA 9.64E-09 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906527724 NA 8.48E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906527724 5.42E-06 NA mr1904_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0906527724 4.11E-06 4.10E-06 mr1947_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251